Транспортер это: ТРАНСПОРТЕР — это… Что такое ТРАНСПОРТЕР?

Содержание

ТРАНСПОРТЕР - это... Что такое ТРАНСПОРТЕР?

  • ТРАНСПОРТЕР — устройство для перемещения грузов в горизонтальном и слегка наклонном направлении. По виду перемещаемого груза, характеру и условиям производства работы Т. бывают разных типов и конструкций. Основными являются: ленточные и скребковые для сыпучих… …   Технический железнодорожный словарь

  • ТРАНСПОРТЕР — и ТРАНСПОРТЁР, транспортера, муж. (от лат. transporto переношу). 1. Устройство для беспрерывного передвижения грузов, деталей и т.д., конвейер (тех.). 2. Поворотная тележка, с помощью которой перемещают автомобиль в гараже без пуска двигателя… …   Толковый словарь Ушакова

  • транспортер — отвалообразователь, шнек, бандваген, лесотаска, питкарлодер, элеватор, конвейер Словарь русских синонимов. транспортер сущ., кол во синонимов: 27 • автотранспортер (2) …   Словарь синонимов

  • ТРАНСПОРТЕР — то же, что конвейер …   Большой Энциклопедический словарь

  • Транспортер — [conveyer] Смотри также Конвейер: Смотри также: цепной транспортер пластинчато ленточный транспортер пальцевый транспортер …   Энциклопедический словарь по металлургии

  • транспортер — ▲ стационарное транспортное средство транспортер двигающаяся дорожка; устройство, перемещающее груз по себе. конвейер. рольганг. шнек …   Идеографический словарь русского языка

  • Транспортер — транспортёр I м. Грузоподъемное вертикальное или наклонное механическое устройство для беспрерывного перемещения сыпучих или штучных грузов, отдельных деталей и т.п.; конвейер, элеватор II. II м. 1. Многоосная платформа, предназначенная для… …   Современный толковый словарь русского языка Ефремовой

  • ТРАНСПОРТЕР — приспособление для передвижения грузов в горизонтальном или наклонном направлении. Т. является также частью сложных машин (уборочные машины, комбайны, силосорезки и т. д). Т. состоит из бесконечного полотна, надетого на валики, или из двух… …   Сельскохозяйственный словарь-справочник

  • Транспортер — …   Википедия

  • транспортер — Syn: конвейер …   Тезаурус русской деловой лексики

  • ТРАНСПОРТЕР - это... Что такое ТРАНСПОРТЕР?

  • ТРАНСПОРТЕР

    — и ТРАНСПОРТЁР, транспортера, муж. (от лат. transporto переношу). 1. Устройство для беспрерывного передвижения грузов, деталей и т.д., конвейер (тех.). 2. Поворотная тележка, с помощью которой перемещают автомобиль в гараже без пуска двигателя… …   Толковый словарь Ушакова

  • ТРАНСПОРТЕР — и ТРАНСПОРТЁР, транспортера, муж. (от лат. transporto переношу). 1. Устройство для беспрерывного передвижения грузов, деталей и т.д., конвейер (тех.). 2. Поворотная тележка, с помощью которой перемещают автомобиль в гараже без пуска двигателя… …   Толковый словарь Ушакова

  • транспортер — отвалообразователь, шнек, бандваген, лесотаска, питкарлодер, элеватор, конвейер Словарь русских синонимов. транспортер сущ., кол во синонимов: 27 • автотранспортер (2) …   Словарь синонимов

  • ТРАНСПОРТЕР — то же, что конвейер …   Большой Энциклопедический словарь

  • Транспортер — [conveyer] Смотри также Конвейер: Смотри также: цепной транспортер пластинчато ленточный транспортер пальцевый транспортер …   Энциклопедический словарь по металлургии

  • транспортер

    — ▲ стационарное транспортное средство транспортер двигающаяся дорожка; устройство, перемещающее груз по себе. конвейер. рольганг. шнек …   Идеографический словарь русского языка

  • Транспортер — транспортёр I м. Грузоподъемное вертикальное или наклонное механическое устройство для беспрерывного перемещения сыпучих или штучных грузов, отдельных деталей и т.п.; конвейер, элеватор II. II м. 1. Многоосная платформа, предназначенная для… …   Современный толковый словарь русского языка Ефремовой

  • ТРАНСПОРТЕР — приспособление для передвижения грузов в горизонтальном или наклонном направлении. Т. является также частью сложных машин (уборочные машины, комбайны, силосорезки и т. д). Т. состоит из бесконечного полотна, надетого на валики, или из двух… …   Сельскохозяйственный словарь-справочник

  • Транспортер — …   Википедия

  • транспортер — Syn: конвейер …   Тезаурус русской деловой лексики

  • Вагон транспортер - устройство, характеристики и типы вагонов транспортеров

    Вагон транспортер - это специальное железнодорожное средство предназначено для таких работ, как транспортировка и перевозка всевозможных грузов, которые имеют большие габариты, и являются достаточно тяжеловесными. Ярким примером использования вагона транспортера может быть перевозка трансформаторов, или разных крупным по размерам и массе частей турбин,  разного рода станин и так далее.

     

    Разновидности вагона транспортера


    Как правило, вагон транспортер не выполняется в одном варианте, а имеет несколько разновидностей. К ним можно отнести такие, как например вагон транспортер колодцевого типа, платформенный вагон транспортер, вагон сцепного вида, и наконец, сочленные и площадочные разновидности вагонов транспортеров.


    Транспортер площадочного вида выполнен таким образом, что балка, которая имеет изогнутую форму, функционирует в виде несущей системы, имеет в основании специальную площадку, которая предназначается для размещения на ней груза. Грузоподъемность такого типа вагонов имеет немалые пределы, а именно может варьироваться в пределах от пятидесяти пяти до двухсот двадцати тонн.


    Следующей разновидностью транспортерного типа вагонов является такой тип, как транспортеры платформенного типа. В данных вагонах несущая балка имеет отличие от предыдущего типа вагонов тем, что имеет прямую форму. Транспортеры колодцевого типа имеют так же конструктивные отличия имен по форме балки, которая в данном случае имеет форму колодца, отсюда собственно и название данных вагонов.

     

     

    Следующей разновидностью вагонов транспортеров является сцепная версия данного средства. Их конструкция состоит в том, что смонтирована из нескольких секционных частей, две из которых являются основными, а остальные вспомогательными. Данные вагоны могут быть двенадцати, шестнадцати и тридцати двухосными, а грузоподъемность самого большого из данных транспортеров достигает четырехсот восьмидесяти тонн.

     

     

     

    И, наконец, сочленные вагоны транспортеры, как правило, имеют такие конструктивные особенности, что выполняются из пары основных секций, консоли которых производят опору на ходовую часть. Данные транспортеры являются самыми  производительными из всех ранее названных транспортеров, поскольку их грузоподъемность может достигать пятисот тонн. Применение их происходит повсеместно, поскольку постоянно существует необходимость к перевозке тяжеловесного негабаритного груза.

     

    Основные характеристики вагонов транспортеров


    Как правило, центр тяжести такого типа вагонов находится на низки пределах, для обеспечения большей грузоподъемности и правильности работы.


    На сегодняшний день, когда энергетическая отрасль все более и более развивается, постоянно возрастает необходимость в модернизации и увеличении грузоподъемности такого рода вагонов. Как правило, даже вагоны с такими мощнейшими показателями, как грузоподъемность, которая превышает пороги в семьсот тонн и то, не останется невостребованной. Длина транспортеров так же зависит от того, к какому типу вагонов-транспортеров принадлежит тот или иной, однако она имеет средние показатели, и не бывает менее чем пятнадцать метров, а достигать может до семидесяти метров, когда этого требует груз.


    Вагоны транспортеры могут выполняться с различными количествами пар колес, это зависит опять же от типа вагона транспортера, однако цифра эта колеблется в пределах от четырех колесных пар, до тридцати двух. Несомненно, что в динамично развивающихся странах, где рост энергетических и оборонных предприятия имеет большой уровень, использование вагонов такого типа является частым и широко востребованным.

    Транспортеры

    Транспортеры

    Транспортеры - это средства передвижения, с помощью которых выполняется перемещение материальных объектов в моделируемом пространстве. Они задаются с помощью блока TransporterFleet Библиотеки производственных систем.

    В зависимости от выбранного типа навигации, движение транспортеров осуществляется по сетевым путям и узлам или произвольно. Дополнительные правила навигации для автопарков с транспортерами, которые двигаются по заданным путям, можно настроить в блоке TransporterControl. В том же блоке вы можете задать для транспортеров свой собственный нестандартный маршрут. По умолчанию, транспортеры с одинаковым типом навигации считают друг друга препятствиями и двигаются соответствующим образом, но вы также можете задать подобное поведение и между транспортерами с разными типами навигации.

    При построении маршрута транспортеры могут учитывать прямоугольные и многоугольные узлы с ограничениями доступа. Любой путь, который хотя бы частично пересекает узел с ограниченным доступом, тоже становится недоступным для транспортера. Если транспортер с навигацией по заданному пути двигается по пути к узлу, который становится недоступным, он остановится на границе узла и будет ждать, когда снимется ограничение на вход. Если в этот момент произойдет пересчет маршрута, но новый маршрут все равно будет требовать прохода через закрытый узел, транспортер выйдет из очереди ожидания на границе узла и войдет в нее снова.

    Если транспортер попал в узел, который на данный момент закрыт, с помощью лифта или гейта между уровнями, то он останавливается в этом узле и ждет, пока узел не откроется снова. Лифт, который привез транспортер, освобождается и может быть захвачен другим транспортером.

    Вы можете задать базовое местоположение, куда транспортеры могут возвращаться, когда их освобождают.

    Каждый отдельный транспортер собирает статистику своего использования.

    Движением транспортера управляет блок MoveByTransporter Библиотеки производственных систем. Этот блок обладает всеми необходимыми параметрами, чтобы захватить транспортер, погрузить на него материальный объект, задать точку назначения и освободить транспортер, когда он достигнет места назначения.

    Если вам нужно создать модель для более сложного процесса, то вы можете захватить и освободить транспортер с помощью отдельных блоков: SeizeTransporter используется для захвата транспортера, а ReleaseTransporter - для его освобождения.

    Вы можете отложить начало движения транспортеров, задав период ожидания для составления маршрута в соответствующем параметре блока TransporterFleet.


    См. также

    Функции транспортеров

    Навигация по заданному пути

    Произвольная навигация

    Программное создание нестандартного маршрута

    Ленточные конвейры и транспортеры. Нетмус

    12 декабря 2018

    В отличие от стандартного агрегата рабочий элемент реверсивного ленточного конвейера может двигаться в обе противоположные стороны. Наличие специального реверса делает возможным быстрое изменение направления во время непрерывного процесса. Это увеличивает производительность и удобство эксплуатации устройства.

    Отличительные особенности реверсивного конвейера

    Опорная конструкция механизма прочная и надежная. Она может быть изготовлена из профиля или швеллера. Электрический двигатель запускает вращение приводного барабана, который в свою очередь приводит в движение ролики.

    Реверс может срабатывать путем ручного или автоматического запуска. Благодаря этому возможно перемещение груза в оба направления на одном устройстве. Это также экономит время работы и занимаемую площадь.

    Реверсивные конвейеры бывают горизонтальными, наклонными и регулируемыми. По типу трассы различают Z-, L- и V-образные агрегаты.

    Отличается размер ленты. Ширина может составлять 100-3500 мм, длина – от 1 до 100 м. Тип рабочего элемента зависит от вида и веса транспортируемых грузов. Для изготовления ленты компания «Нетмус» использует только высококачественные синтетические материалы.

    Несущая лента бывает следующих типов:

    • ПВХ;
    • резинотканевая;
    • резинотросовая.

     

    Специальное антикоррозийное покрытие делает материалы износостойкими и долговечными. Они устойчивы к истиранию, не растягиваются и не деформируются под воздействием груза. Чтобы повысить угол подъема, используются рифленые или прижимные ленты.

    Конвейерный транспортер может использоваться в закрытых помещениях и на открытых площадках. В промышленных учреждениях обычно используются стационарные устройства. Для работы вне помещения лучше подходит передвижной мобильный механизм.

    Комплектация и преимущества реверсивного транспортера

    Некоторые модели оснащены дополнительными приспособлениями, такими как:

    • очиститель ленты;
    • защитные бортики;
    • стыковочный элемент;
    • весы;
    • сбрасыватель;
    • бункер.

     

    Наклонные ленточные транспортеры с бункером могут производить погрузку и разгрузку из погрузчиков и кузовов самосвалов. Устройство предназначено для подачи материалов непосредственно из или в бункер. Его объем может составлять 1,5 кубометра. Такое специальное оборудование сокращает простой загрузочных средств и обеспечивает беспрерывный рабочий процесс.

    Преимущества ленточных реверсивных конвейеров:

    • высокая производительность;
    • регулировка скорости и направления движения;
    • устойчивость к повреждениям;
    • простая загрузка и выгрузка;
    • транспортировка разных видов продукции.

     

    Ленточный реверсивный конвейер – универсальное и многофункциональное устройство, которое осуществляет непрерывную транспортировку различных материалов в обе стороны. Транспортер нашел широкое применение в крупной промышленности и в мелком производстве.

    Оборудование для переработки Нетмус

    Встроенный верхний транспортер ткани | Micron

    Встроенный верхний транспортер обеспечивает одновременное продвижение материала снизу и сверху, что позволяет избежать нежелательного сдвига слоев ткани относительно друг друга. Присутствует в моделях «Micron Сlassic» 1035 и 1037.

     

    Именно из-­за наличия верхнего транспортера швейные машины Micron Сlassic относятся к полупрофессиональным швейным машинам.

    Давайте разберем подробно, как происходит продвижение ткани при пошиве изделия на бытовой швейной машине. На рисунке буква (В) обозначает направление движения верхнего слоя ткани.

    Соответственно, буква (Н), обозначает направление движения нижнего слоя ткани.

    Ткань при шитье продвигается с помощью зубчатой рейки, расположенной на платформе швейной машины. Рейка продвигает материал, который соприкасается с ней, т. е. нижний слой ткани.

    Верхний слой при этом движется только за счет небольшого сцепления с нижним и притормаживается самой лапкой.

    Это приводит к тому, что скорость движения нижнего слоя ткани больше, чем скорость движения верхнего слоя, за счет чего и происходит сдвиг слоев ткани относительно друг друга, и может появиться нежелательная сборка.

    Избежать смещения слоев ткани между собой помогает верхний транспортер – устройствo, котoрое прoдвигает верхний слой ткaни.

    На рисунке видно, что верхний слой ткани (В) и нижний слой ткани (Н) зажимаются между зубчатой рейкой и верхним транспортером и продвигаются с одинаковой скоростью. Это позволяет избегать сдвига слоев ткани и образования нежелательной сборки.

    Верхний транспортер незаменим при работе со сложными тканями, как тонкими – такими, как шелк, шифон, вискоза, так и очень плотными, а также при простегивании или сшивании большого количества слоев ткани.

    Преимущество встроенного верхнего транспортера перед съемным транспортером заключается в том, что он позволяет работать с любой сменной лапкой.

    Съeмный транспортер, как правило, устанавливается вместо обычной лапки и не может быть использован при выполнении специфических операций.

     

    Фольксваген Транспортер 2021 в Москве

    Фаворит Хофф на Варшавке

    Официальный дилер Volkswagen

    Volkswagen Transporter T6 2018-2019 - это известный во всем мире коммерческий транспорт немецкого бренда. Большая грузоподъемность, универсальность, вместительность и надежность сделали модель востребованной в различных сегментах бизнеса. Автомобиль был сконструирован в 1947 году Беном Поном - партнером компании - на платформе легендарного Фольксваген Жук.

    Сегодня Transporter представлен впечатляющим модельным рядом, который включает фургоны, пассажирские версии Kombi и DoKa, грузовики с открытой платформой, шасси и др.

    Специальные предложения

    Покупка

    Новый будет лучше! Для ценителей больших автомобилей

    Специальные условия на покупку нового Volkswagen взамен старого.

    Технические характеристики и габариты Volkswagen Transporter

    Фургон Фольксваген Транспортер Кастен достигает 5304 мм в длину. Ширина автомобиля - 1904 мм, высота - 1990 мм.

    Клиренс - 202 мм. Такой дорожный просвет позволяет автомобилю легко преодолевать ямы на бездорожье и искусственные неровности в городе.

    Грузоподъемность - от 1222 до 1455 кг.

    Модели агрегатируются бензиновыми и дизельными моторами объемом 2 литра и мощностью от 102 до 204 л.с. В паре с моторами функционирует классическая механика или 7-диапазонная DSG.

    Максимальная скорость фургона - от 145 до 202 км/ч в зависимости от типа мотора и колесной базы.

    Расход топлива - от 7,2 до 10,5 литров на 100 км пути (смешанный цикл).

    Модельный ряд Transporter включает автомобили с передним приводом и полным приводом 4MOTION, с которым не страшны даже заснеженные дороги.


    Внешний вид и дизайн


    Дизайн

    Transporter является воплощением стилистики марки, которая объединяет геометричность с элегантностью. Строгие черты кузова, чистые линии крыши, большая площадь остекления, уверенные очертания капота придают автомобилю уверенности и брутальности. Это впечатление усиливает массивный черный бампер с футуристичным воздухозаборником. Головная оптика и противотуманные фары делают образ авто изящным.


    Экстерьер

    На выбор покупателям предлагается несколько цветовых решений кузова. Дизайнеры сделали акцент на сочные цвета, но не забыли и о классике. Вы можете приобрести автомобиль белого цвета, который выглядит аристократично и эффектно, или остановиться на модели глубокого синего, колоритного оранжевого или терпкого вишневого тона. Какой бы выбор вы ни сделали, Ваш автомобиль будет выделяться в автопотоке.


    Практичность

    Пространство грузового отделения вы легко сможете организовать в соответствии со своими потребностями. Благодаря съемной сетчатой перегородке, груз не помешает комфорту пассажиров. А с антискользящим резиновым напольным покрытием вещи будут оставаться на своем месте во время движения.

    Автомобили предлагаются с подъемными или раздвижными задними дверями. Все модели агрегатируются сдвижной правой дверью.


    Интерьер

    Лаконичный, функциональный, сдержанный – во внутреннем пространстве Transporter вы не найдете ни одной лишней детали. Для нужных в пути мелочей предусмотрено множество полок и ниш, а конструкция водительского кресла разрабатывалась совместно с ортопедами. Оно оснащено поясничной опорой и удобными подлокотниками. Руль можно отрегулировать по вылету и высоте.

    Стандартное переднее кресло, рассчитанное на одного пассажира, можно заменить на практичное двухместное сиденье.


    Вместительность

    Transporter 2021-2020 – это не только гигантский грузовой отсек или просторный пассажирский салон, но еще и продуманная до мелочей система хранения. Над головой водителя располагается футляр для очков, над информационно-развлекательной системой находится ниша, куда поместятся бумаги А4, а небольшие открытые ниши предназначены для хранения ключей и телефона.

    Двери оснащены двумя вместительными карманами, а ценные вещи можно спрятать в бардачке, который закрывается при помощи ключа зажигания.


    Универсальность

    Вне зависимости от того, что вы будете транспортировать в фургоне, вы сможете безопасно расположить и зафиксировать груз. Изнутри кузов обит ламинированными панелями. Опционально монтируются растровые шины. Все это не допустит нарушения целостности груза во время движения.

    Складные такелажные петли (от 6 до 8 штук в зависимости от версии автомобиля) помогут зафиксировать груз или установить эластичную сетку. В сложенном состоянии петли практически незаметны.

    Электрическая регулировка поясничной опоры

    Электрическая регулировка поясничной опоры

    Правильно отрегулированное и удобное сиденье водителя – залог высокой работоспособности водителя и безопасной поездки. Именно поэтому конструкторы концерна «Фольксваг

    Определение транспортера Merriam-Webster

    транспорт · порт · эр | \ tran (t) s-ˈpȯr-tər , ˈTran (t) s-ˌpȯr- \

    Определение

    транспортер

    Транспортер | Альфа памяти | Fandom

    Multiple Realities
    (охватывает информацию из нескольких альтернативных временных линий)

    " Транспортировка - действительно самый безопасный способ путешествовать. "

    Refit Конституция -класс транспортная комната

    Defiant -классовая транспортная комната

    Транспортер был подпространственным устройством, способным почти мгновенно транспортировать объект из одного места в другое, используя преобразование материи-энергии для преобразования материи. в энергию, затем направляет его в камеру или из нее, где он снова преобразуется обратно в свой первоначальный узор. (TOS: «Сквайр Готоса», «Дикий занавес»)

    Альтернативные названия транспортера включают преобразователь потока материи , скремблер энергии-вещества или устройство транспортировки .(TOS: «Дикий занавес», «Эмпат»; ENT: «Сломанный лук», «Точка исчезновения»; TNG: «Корабль в бутылке»; VOY: «Ex Post Facto»). Органианцы называли клингонских транспортеров единицы передачи материала . (TOS: «Поручение милосердия») Ференги называли свое устройство материей-энергией . (TNG: «Последний форпост») Спок определил, что устройство, используемое вианами, которое направило его, Леонарда Маккоя и Джеймса Т. Кирка в подземное место на планете Минара II, было тем, что он описал как материю-энергию года. Сигарет .(TOS: "Эмпат")

    Кто-то, кого транспортировала балка транспортера, был известен как транспортер . (TOS: "День голубя")

    История

    22 век

    Эмори Эриксон, изобретатель транспортера, с дочерью Даникой Эриксон. «Отец Транспортера».Первый действующий транспортер был разработан примерно в 2124 году.

    Эриксон позже вспоминал о своем опыте, когда он первым прошел через транспортер, и он боялся попытаться это сделать. По словам Эриксона, « этому оригинальному транспортеру потребовалось полторы минуты, чтобы пройти весь цикл. Чувствовал себя как год. Вы действительно могли почувствовать, что вас разделяют и снова собирают вместе. Когда я материализовался, первое, что я сделал, это потерял свой обед. Второе, что я сделал, это напился как камень. Годы спустя Эриксон посетовал на то, что « во время начальных испытаний транспортера, несколько храбрых мужчин и женщин были потеряны, » добавил: « не проходит и дня, чтобы я не делал. не думаю о них. «Хотя его видение было успешным, он никогда не смог вернуть себе былую славу, поскольку его последующие усилия с субквантовой телепортацией так и не были реализованы, усилия, которые в конечном итоге привели к потере его сына, Куинна. (ЛОР:« Дедал » ")

    В иллюзии, созданной в течение восьми секунд Хоши Сато в буфере шаблонов, ее разум создал вымышленную историю о человеке по имени Сайрус Рэмси. В этой очевидной истории о привидении, рассказанной через иллюзию Трип Такера, событие произошло в Мэдисоне, штат Висконсин, в мае 2146 года, где «Рэмси был подопытным для первого дальнего транспорта».Всего сто метров. Что-то пошло не так с буфером шаблонов. Он никогда не материализовался повторно. "Малкольм Рид, который не мог поверить, что Сато никогда не слышал эту историю раньше, поскольку нельзя" выжить в одночасье, не услышав рассказ о ком-то, кто видел рематериализацию молекул Рэмси в туманную ночь. "(ЛОР:" точка схода ")

    Потомки колонистов, основавших раннее поселение людей на планете Терра 10, сохранили знания о транспортных технологиях, по крайней мере, до 2269 года, а также код интерсат, хотя этот метод связи вышел из употребления за два столетия до этого.(ТАС: "Терратинский инцидент")

    Ранние попытки Звездного Флота по применению транспортной технологии были аналогичны транспортным средствам 24-го века, используемым лигонянами, но лигонские транспортники использовали метод гегленского сдвига для преобразования материи и энергии. (TNG: «Кодекс чести»)

    Enterprise NX-01 был одним из первых звездолетов Звездного Флота, оснащенным транспортером, предназначенным для перевозки биологических объектов. Первоначально, однако, он использовался очень редко из-за общего недоверия к технологии членов экипажа Enterprise .(Сам капитан отказался пропустить свою собаку через систему.) Его использование стало гораздо более распространенным во время поисков Enterprise в Дельфийских просторах. (ЛОР: «Сломанный лук», «Странный новый мир», «Андорианский инцидент», «Удачливый сын», «Инкубаторий»; «Обратный отсчет», и др. ))

    В качестве показателя возможностей этого типа раннего транспортера Мэтью Райан заявил в первом наброске сценария «Удачливого сына», что дюжина из них позволит экипажу ECS Fortunate разгрузить это судно в час.

    Эти ранние транспортеры были не очень надежными, и даже после миссии Enterprise большинство из них было разрешено только для небиологических перевозок. Даже когда использование транспортеров стало обычным явлением, большинство людей и других рас на аналогичной стадии технологического развития предпочитали традиционные методы передвижения. (ЛОР: «Странный новый мир», «Андорианский инцидент», «Дедал»)

    По мере того как Звездный флот продолжал исследование космоса, зависимость от транспортеров значительно росла.Транспортеры могут значительно упростить выездные миссии, исключив необходимость в шаттлах. В случае чрезвычайных ситуаций (медицинских или иных) сэкономленное время может означать разницу между жизнью и смертью. (ЛОР: «Странный новый мир»)

    До 2164 года, по крайней мере, на звездолетах класса Freedom , транспортеры предназначались только для грузов, а не для органических веществ. Однако они могут быть модифицированы для транспортировки органических веществ с некоторым риском. ( Звездный путь за пределами )

    23 век

    С появлением более безопасных переносчиков биологический транспорт стал все более распространенным явлением, что привело к появлению первых болезней, связанных с переносчиками.Самым известным заболеванием был психоз переносчика, который был диагностирован в 2209 году на Делинии II. После совершенствования буферов мультиплексных шаблонов такие случаи были практически исключены. (TNG: "Царство страха")

    Боковой переносчик векторов, используемый в 2249

    К 2249 г. были достигнуты дальнейшие успехи в совершенствовании технологии, на этот раз за счет снижения энергопотребления. Старые юниты, такие как боковые переносчики векторов, были отброшены на Вулкане из-за того, что им требовалось огромное количество энергии.Звездный флот также отказался от них, но на некоторых старых кораблях, таких как Walker класса USS Shenzhou , они все еще были установлены. (DIS: "Битва у двойных звезд")

    24 век

    К 24 веку транспортеры стали самым надежным средством передвижения на короткие расстояния. (TNG: "Царство страха")

    Большинство космических цивилизаций Альфа- и Бета-квадрантов использовали транспортную технологию для перевозки персонала и оборудования на короткие расстояния, однако эта технология все еще была малоизвестной в дальних уголках Дельта-квадранта.Для этих видов многочисленные преимущества использования транспортеров и репликаторов сделали технологию предметом спора, особенно между «Kazon» и командой USS Voyager . (ВОЙ: «Смотритель», «Маневры» и др.)

    Путешествие на транспортере было по существу мгновенным, и у человека практически отсутствовало чувство времени во время транспортировки. Бенджамин Сиско и Гарри Ким, обучаясь в Академии Звездного Флота в Сан-Франциско, часто перебрасывались в Новый Орлеан и Южную Каролину, соответственно, навестить своих родителей.(DS9: "Исследователи"; VOY: "Non Sequitur")

    Инновации в транспортной технологии примерно того времени включали более безопасную транспортировку от места к месту, что позволяло осуществлять транспортировку между двумя местами без предварительного возврата в помещение для перевозки. (TNG: «Игра» и др.)

    К 29 веку Звездный флот разработал технологию временного транспортера, которая позволяла путешествовать во времени аналогично стандартным транспортерам предыдущих веков. (ВОЙ: "Относительность")

    Операции

    Начальник транспортера Wyatt

    В целом, начальник транспортера отвечал за оперативную готовность, техническое обслуживание и ремонт транспортных систем корабля или станции.

    Типичная транспортная последовательность, обычно инициируемая запросом на «подачу энергии», начиналась с консоли транспортера с предварительной секвенированием транспортера, после чего координаты транспортера устанавливались на объекте или пункте назначения с помощью нацеленных сканеров, которые впоследствии стали транспортером. замок был сделан. (ВОЙ: «Джетрел», «Посвящения», «Скрученный»)

    Одновременно объект распался на поток субатомных частиц, также называемый потоком материи. (TNG: "Datalore") Затем сигнал транспортера был передан в буфер шаблона, а затем снова передан в массив эмиттера.(VOY: «Глаз иглы», «Скрученный») Затем поток материи был передан к месту назначения через подпространственный домен. (TNG: «Лучшее из обоих миров, часть II») При использовании транспортер оставил в воздухе остаточную ионизацию. (TNG: "Высокий уровень")

    Из всего этого процесса ничего не почувствовал. (TNG: "Дофин")

    Эффект транспортера USS из альтернативной реальности Enterprise

    В 2258 году в альтернативной реальности рабочий процесс транспортера включал использование кольцевого ограничивающего луча с последующей электромагнитной фокусировкой и использованием гравитационного компенсатора.Затем оператор транспортера применил временной дифференциал и включил блокировку частиц. ( Звездный путь )

    Информация о процессе транспортера альтернативной реальности поступает из экранной графики панели управления транспортера, показанной в нескольких сценах фильма Star Trek .

    Транспортные системы клингонов двадцать третьего века использовали ту же базовую технологию, что и транспортные системы Федерации. Несмотря на то, что транспортные системы класса Intrepid были намного сложнее, чем у класса D7, сканеры наведения работали по тем же принципам.За исключением более совершенных систем, у которых была возможность увеличивать буферную емкость транспортера, они действительно не так уж сильно отличались. (VOY: "Пророчество")

    По состоянию на 2368 год кардассианские транспортные системы все еще работали с активными буферами схемы подачи. (TNG: "Раненые")

    Также в этот период времени ромуланские транспортеры, как известно, работали на такой же подпространственной частоте, что и на борту звездолетов Федерации, и лишь с небольшими корректировками они могли быть сделаны для имитации несущих волн транспортеров, используемых их коллегами из Федерации.(TNG: "День данных")

    С самых ранних воплощений до 2270-х годов транспортеры обычно иммобилизировали объект, на который был направлен луч, во время дематериализации и рематериализации. Развитие транспортных технологий после этого момента позволило человеку перемещаться или разговаривать во время процесса ограниченным образом. ( Star Trek: The Motion Picture , Star Trek II: The Wrath of Khan )

    К 24-му веку нарукавные повязки, транспондеры и гребенки аварийного транспортера можно было запрограммировать на дистанционную активацию транспортера.Обычно дистанционное включение транспортера ограничивалось аварийными ситуациями или отсутствием экипажа судна на борту. (TNG: «Лучшее из обоих миров», «Царство страха»; DS9: «Джем'Хадар»)

    Функции безопасности, протоколы и компоненты

    Как и другие технологии Звездного Флота, у транспортера был свой собственный набор функций безопасности, протоколов и процедур. В аварийной ситуации многие из этих систем безопасности можно изменить или обойти.

    Ранние версии транспортера в 22 веке, похоже, не имели защиты от внешних вторжений в действующий транспорт.«Посторонние предметы», такие как взорвавшиеся обломки, могут попасть в транспортное средство и врасти в объект или интегрироваться в него. (ЛОР: «Странный новый мир») Огонь из энергетического оружия также повлияет на объект, если только он не окажется достаточно далеко в транспорте, чтобы огонь прошел через него безвредно. (ЛОР: «Сломанный лук», «Обратный отсчет») Однако к концу 23-го века транспортеры защитили объект от этих внешних вторжений. ( «Звездный путь VI: неоткрытая страна» ; TNG: «Вопрос перспективы»). Они даже могли нейтрализовать огонь из оружия из частиц, инициированный во время транспортировки.(TNG: "Самые игрушки")

    Семь из Девяти данных транспортера

    Биофильтры единообразно использовались на всех транспортерах Федерации к 24 веку. Эти фильтры предназначены для обеззараживания транспортируемых объектов и предотвращения загрязнения остальной части корабля или станции вредными веществами, патогенами и даже некоторыми формами излучения (включая тета-излучение). Этот процесс заменил более ранние системы, которые требовали, чтобы субъект был полностью рематериализован на транспортной платформе перед применением энергетического процесса для местной дезактивации транспортируемого объекта.(VOY: «Макрокосм», «Ночь»; TOS: «Обнаженное время»)

    Хотя биофильтры выполняли общее удаление загрязняющих веществ при каждой транспортировке, они были далеки от совершенства; ранее неизвестные инфекции или вирусы иногда не регистрировались, что требовало повторной калибровки фильтров для распознавания новой угрозы. Таким образом, биофильтры были неспособны отфильтровывать определенные типы веществ и патогенов, в первую очередь психическую энергию. (TNG: «Одинокие среди нас», «Power Play»)

    Биофильтры также не могли обнаруживать и фильтровать определенные типы фазированных форм жизни без предварительной калибровки.Биофильтры также функционировали для обнаружения и обезвреживания оружия и взрывчатых веществ (например, передатчиков-детонаторов). (TNG: «Царство страха», «Шизоидный человек», «Самые игрушки»)

    Транспортер также сохранил биологические данные перемещенных лиц. В 2374 году Доктор смогла поставить диагноз иррациональному поведению Седьмой из Девяти после изучения ее последних записанных данных о транспортере. (ГОЛОС: "Ворон")

    При сознательной транспортировке материала, считающегося биологической опасностью, такого как вирус, разрешение на биотранспорт использовалось для документирования природы материала и утверждения транспортировки.(TNG: "Дитя")

    Протоколы запрещают транспортировку предметов во время движения на варповой скорости, за исключением чрезвычайных ситуаций. (TNG: «Шизоидный человек») Такие перевозки возможны, однако, если два корабля соответствуют скоростям варпа. (TNG: «Лучшее из обоих миров»; VOY: «Маневры»)

    Диапазон

    В 22 веке стандартные земные транспортные системы имели дальность действия десять тысяч километров; однако к 24 веку максимальная дальность действия стандартных транспортных систем составляла около сорока тысяч километров, хотя особый вид транспорта, называемый подпространственным транспортом, мог перемещаться на расстояние в несколько световых лет.(ENT: «Раджин»; TNG: «Дело чести», «Родословные»). Многие звездолеты 24-го века были оборудованы системой аварийного транспорта, но они имели дальность действия в лучшем случае десять километров. (VOY: "Конец будущего")

    Несмотря на максимальную дальность действия около сорока тысяч километров, некоторые условия отрицательно сказывались на эффективной дальности. По крайней мере, в одном случае - из-за отсутствия компонентов основных компьютерных систем Voyager - звездолет Voyager должен был находиться в пределах пятисот километров от поверхности планеты, чтобы использовать транспортеры на Кэтрин Джейнвей и голограмму Леонардо да Винчи.(ВОЙ: «Относительно полета»)

    Для контекста, пятьсот километров над поверхностью Земли поместят корабль внутри ионосферы, но он все равно будет примерно на сто километров выше орбиты, поддерживаемой Международной космической станцией.

    Максимальная дальность действия транспортера различалась для разных видов, в зависимости от того, какие технологии они использовали для его создания. Транспортер с самой большой известной дальностью полета был у сикарианцев - около сорока тысяч световых лет; однако это произошло из-за большой кварцевой мантии их планеты, которая усиливала сигнал их транспортера.Из-за этого технология транспортеров Сикариана работала только на их родном мире. (VOY: "Prime Factors")

    По словам Спока, таинственные спонсоры Гэри Севена на планете Назначающих обладали транспортными технологиями с радиусом действия не менее тысячи световых лет. Позже Монтгомери Скотт заметил, что луч Семерки был настолько мощным, что соединил все записывающие схемы, и поэтому он не мог точно сказать, как далеко он перенес Семь, или даже перенес ли он его во времени. Как именно они достигли этого эффекта, остается неизвестным, поскольку с ними не было никакого последующего контакта, и они каким-то образом скрывают весь свой родной мир.Однако были и другие признаки того, что их технология значительно продвинулась по сравнению с Федерацией 23-го века. (TOS: "Назначение: Земля")

    Ведала, одна из древнейших космических рас, также обладала транспортной техникой, способной перебрасывать людей и оборудование на другие планеты (предположительно в разных звездных системах). (ТАС: «Джихад») Транспортная технология Доминиона, усиленная самонаводящимся транспондером, имела радиус действия не менее трех световых лет.(DS9: «Завет»)

    Инструменты для диагностики и обслуживания

    Системные компоненты

    Диагностика уровня 4 с перечнем нескольких ключевых компонентов

    Типы транспортеров

    Почти все объекты Звездного Флота и звездолеты были оборудованы по крайней мере одним транспортным средством. Различалось количество транспортных устройств; например, у большинства шаттлов был один транспортер, а у звездолетов класса Galaxy - двадцать. (TNG: "11001001")

    На судах, где были грузовые отсеки, часто можно было встретить и грузовые транспортеры.

    Производство транспортеров Mark V было остановлено в 2356 году. К 2371 году транспортеры Mark VI считались устаревшими. Транспортеры Mark VII были способны транспортировать нестабильную биоматерию, пока был отрегулирован ингибитор фазового перехода. (DS9: "Семейный бизнес")

    Персонал

    Консоль транспортера, 2254

    Стандартная консоль транспортера duotronic (прибл. 2260)

    Консоль транспортера в альтернативной реальности 2258

    Самым распространенным типом транспортера был транспортер для персонала, предназначенный в первую очередь для персонала.

    Помещения для перевозки персонала обычно состояли из консоли транспортера, платформы транспортера с потолочным сканером молекулярной визуализации, первичных катушек возбуждения и катушек фазового перехода.

    Буфер для выкройки с биофильтром обычно располагался на палубе под транспортным помещением. Внешний корпус звездолета включал в себя несколько эмиттеров для луча транспортера. (TNG: «Царство страха»; VOY: «Макрокосм»)

    Перевозчики персонала работали на квантовом уровне, чтобы обеспечить безопасную транспортировку форм жизни.Биофильтры, встроенные в транспортные системы, предотвращали попадание опасных микроорганизмов на борт судна.

    Платформы Transporter имели различное количество подушек, расположенных в различных компоновках (по модели и производственной гонке).

    Транспортеры, установленные на космических кораблях Земли класса NX, имели одну большую круглую площадку, которая занимала всю платформу. Он был достаточно большим, чтобы вместить двух-трех человек, если они стояли близко друг к другу.

    К 23 веку транспортные платформы Федерации имели несколько независимых опор, обычно шесть в шестиугольной конфигурации.Также были доступны одно- и двухподъемные платформы.

    Это стало чем-то вроде стандартной компоновки для транспортеров Федерации в следующем столетии. Например, платформы, используемые на борту звездолетов класса Galaxy , имели знакомые шесть отдельных площадок, с большой площадкой (в центре платформы), которая могла обрабатывать небольшие грузы.

    Модель транспортера, установленного на борту звездолетов класса Defiant , имела круговую платформу ¾ и три сиденья в треугольном строю.

    Некоторые клингонские платформы 23-го века имели шесть шестиугольных площадок, расположенных по прямой линии. В других, например, в Birds-of-Prey, было небольшое количество платформ в тесной группе. ( Звездный путь IV: Путешествие домой ; Звездный путь VI: Неизведанная страна )

    Кардассианские транспортные платформы в 24 веке имели от трех до пяти треугольных площадок, расположенных близко друг к другу, как те, что установлены на Deep Space 9.

    Транспортное средство для перевозки персонала было надежным, но иногда хрупким устройством.В частности, фазовые катушки были уязвимы для схем обратной связи и могли быть серьезно повреждены в результате скачков напряжения или возгорания фазера низкого уровня. (TNG: "Братья")

    Грузовой

    Грузовой транспортер на борту звездолета класса Galaxy

    Грузовые транспортеры были крупномасштабными версиями транспортеров для персонала и были оптимизированы для перевозки неодушевленных предметов. Эти транспортеры были приспособлены для перевозки огромного количества материала. (TNG: «Симбиоз», «Охота», «Power Play»)

    В случае аварии грузовые транспортеры могут быть переведены в квантовый режим, что сделает возможной транспортировку форм жизни.Одной из причин такой реконфигурации была ускоренная эвакуация персонала. (TNG: "11001001")

    Грузовые транспортеры в основном находились внутри грузового отсека звездолета или космической станции. На уровне 97-C космического дока типа Starbase 74 было четыре грузовых транспортера. (TNG: "11001001")

    Специальные грузовые транспортные платформы, используемые Звездным флотом в 24 веке, обычно имели одну большую круглую или продолговатую площадку. ( Звездный путь: Следующее поколение )

    Транспортер на борту USS Franklin

    В альтернативной реальности USS Franklin был оборудован только грузовыми транспортерами.После обнаружения обломков Franklin Монтгомери Скотт смог модифицировать транспортеры для передачи жизненных форм, хотя он излучал Спока и Леонарда Маккоя на борту только по одному, чтобы не рисковать соединить их вместе. С помощью Павла Чехова Скотт смог дополнительно модифицировать транспортеры, чтобы направлять группы по двадцать человек за раз, хотя транспортеры необходимо было перезаряжать, по крайней мере, после двух групп по двадцать человек подряд. После модификаций Скотта транспортеры также смогли доставить две жизненные формы и мотоцикл к месту назначения. ( Star Trek Beyond )

    Портативный

    Переносные транспортеры - это автономные устройства, способные осуществлять прямую транспортировку с места на место. Имея возможность перемещаться с одного места на другое, они были довольно большими и громоздкими. (DS9: "Провидец")

    В 2372 году по альтернативной шкале времени Том Пэрис владел передовым портативным устройством-транспортером между площадками, способным транспортировать себя вместе со своей полезной нагрузкой. Это устройство было достаточно маленьким, чтобы его можно было легко носить с собой. (VOY: "Non Sequitur")

    Скорая помощь

    Аварийная транспортная единица

    Аварийная транспортная единица была особого типа, требовавшая небольшой мощности; в случае перебоя в электроснабжении всего корабля экипаж мог использовать эти транспортеры для экстренной эвакуации. ( Star Trek: The Next Generation Technical Manual ; VOY: «Конец будущего»)

    В старых технических руководствах и других неканонических справочных материалах их иногда называют «эвакуационными» транспортерами или «боевыми» транспортерами.Обычно это платформы с дюжиной или более площадок на каждой. Помимо аварийной эвакуации, они используются при любом перемещении большого количества персонала, например при развертывании войск.

    К концу 24 века экстренный транспорт был усовершенствован благодаря развитию Звездного Флота одноразового одноразового транспортного средства экстренного транспорта с односторонним движением. Устройство было достаточно маленьким, чтобы его можно было держать в руке, и его можно было перемещать в заданные координаты одним касанием. Из-за своих крайних ограничений это устройство не получило широкого распространения и в 2379 году все еще считалось прототипом.( Звездный путь Немезида )

    Общественный

    Общественный транспортёр в использовании

    Общественный транспортёр - это отдельные транспортные станции, доступные для использования гражданским населением Звездной базы Йорктаун. Эти автоматизированные единицы имели набор заранее запрограммированных координат пункта назначения, доступных каждому пользователю, что позволяло получить доступ ко многим общедоступным местам по всей звездной базе. ( Star Trek Beyond )

    К 2399 году в штаб-квартире Звездного Флота были общественные транспортеры в виде ворот, которые посетители могли использовать, чтобы попасть прямо в помещение.(PIC: «Карты и легенды»)

    Микротранспортеры

    К 2375 году Федерация разработала микротранспортер - по сути, уменьшенную версию обычного транспортера - который был способен транспортировать небольшие количества материала в почти незаметный промежуток времени. Когда он прикреплен к винтовке TR-116, его можно было использовать для транспортировки пули в любое место в пределах досягаемости транспортера, где она продолжала бы двигаться с исходной скоростью, пока не поразила цель. (DS9: "Поле огня")

    Транспортеры без балки

    Пространственный траектор, пример безлучевого транспортера

    Некоторые виды экспериментировали с транспортерами, которые отличались по технологии и теории от тех, которые используются большинством видов, с которыми сталкивается Федерация.

    Известно, что сикарианцы использовали транспортер свернутого пространства, полагаясь на смещение измерений, а не на преобразование материи в энергию. Точно так же иконяне усовершенствовали свой собственный вид транспорта, известный как ворота, который был способен почти мгновенно перемещаться на огромные расстояния. (VOY: "Prime Factors"; TNG: "Contagion")

    Транспортные средства прочие

    Гэри Севен выходит из тумана транспортных камер

    Офис Гэри Севена с транспортной камерой, спрятанной на заднем плане

    Гэри Севен обладал передовой формой транспортных технологий, которые он использовал для перевозки вокруг планеты Земля и обратно на свою родную планету более чем в тысяче световых лет от Земли.Во время работы камера образовывала облако синего туманного вещества, которое окутывало камеру. Камера управлялась компьютером Beta 5 и была первым известным транспортным средством, которое использовалось на Земле, особенно с учетом периода времени 1968 года.

    Луч транспортера может быть перехвачен другим транспортером. Это произошло, когда Гэри Севен находился на пути к Земле, и его луч был случайно перехвачен USS Enterprise , которым командовал Джеймс Т. Кирк.Казалось бы, это означает, что обе технологии транспортеров работают на схожих принципах. Устройство Seven оказалось более мощным, чем у Enterprise , поскольку оно могло перенаправить луч транспортера Enterprise обратно на него, и вместо того, чтобы Gary Seven повторно материализовался в комнате транспортера Предприятие он повторно материализовал в своем собственном устройстве.

    Когда дверь не использовалась, дверца камеры, которая напоминала дверь сейфа, когда она была закрыта, была спрятана за полкой с очками Мартини.Полка и отделка из коричневого дерева вокруг нее разделились посередине и скользнули в соседние стены, позволив дверце камеры открыться. Это действие было достигнуто перемещением правой ручки на столе Гэри Севена вниз. (TOS: "Назначение: Земля")

    Это устройство не было идентифицировано на экране. Согласно окончательному проекту сценария, было заявлено, что « [i] t очевидно, что этот« стенной свод »маскирует то, что на самом деле является высокотехнологичным типом« Транспортера ». »

    Алдейское транспортное устройство

    Альдийцы носили небольшое устройство, прикрепленное к руке, которое они использовали для управления своим транспортером через контакт с Хранителем.(TNG: "Когда сучья ломаются")

    Это устройство было описано в сценарии эпизода как «устройство на руку» или «повязка на руку».

    См. Также

    Ограничения

    Несчастные случаи

    Время

    Щиты

    Как правило, транспортеры нельзя было использовать, когда дефлекторный щит корабля был активен или дефлекторный щит был установлен над местом назначения. Однако можно было воспользоваться преимуществами ЭМ «окон», которые создавались нормальным вращением частот экрана.В эти периоды открывалась дыра, через которую мог пройти луч транспортера. Чтобы использовать это окно, время должно быть абсолютным и обычно требует значительной помощи компьютера. Эта техника была теоретизирована и впервые применена в 2367 г. начальником транспортной службы USS Enterprise -D Майлзом О'Брайеном. Так получилось, что он хорошо знал щиты USS Phoenix , включая время. (TNG: "Раненые")

    Магнитные экраны также могут использоваться для предотвращения излучения. Рура Пенте была защищена таким щитом, чтобы не дать заключенным сбежать.( Звездный путь VI: Неизведанная страна )

    Существовал тип защиты, которая позволяла транспортировать, хотя у нее было ограничение, не позволяющее запускать фазеры через нее. (TOS: «Вкус Армагеддона»)

    Однако ограничение транспортеров по сравнению со щитами не было универсальным. Альдийцы могли проходить через свою собственную защиту с помощью транспортеров, хотя защита была непроницаема для других форм техники и оружия. Точно так же и Борг, и Доминион использовали транспортную технологию, которая могла проникать сквозь стандартную защиту Федерации.Некоторые приспособления, в том числе частота вращения щита, могут подавлять эту способность, но не устраняют ее полностью. (TNG: «Q Who»; DS9: «Джем'Хадар») Вот смог направить целые звездолеты в один городской корабль Вотов, несмотря на то, что его щит был поднят и работал на полную мощность. (ВОЙ: "Дальнее происхождение")

    Скорость искривления

    Использование транспортеров, когда корабль двигался с варп-скоростью, было очень опасно, потому что варп-поля создавали серьезные пространственные искажения. (TNG: «Человек-шизоид») Следовательно, транспортировка на варпе обычно нарушает правила безопасности.Тем не менее, транспортировка в варпе была предпринята несколько раз с некоторыми корректировками. Эти попытки обычно делались в условиях боя с высокими ставками. (TNG: «Лучшее из обоих миров», «Эмиссар»)

    • Если оба корабля сохраняли точную скорость (то есть поле варпа на обоих судах должно иметь одинаковое интегральное значение / коэффициент), транспортировка с варп-скоростью была возможна. Несоблюдение этих скоростей приведет к серьезной потере кольцевого ограничивающего пучка (ACB) и целостности структуры.
    • Если корабль двигался со скоростью варпа, а объект, который нужно направить, был неподвижен, транспортировка была возможна за счет синхронизации ACB с частотой ядра варпа. Это вызовет трудности в получении хорошей блокировки шаблона. Известно, что маки использовали этот метод. (ВОЙ: "Маневры")
    • Примерно до 2387 года Монтгомери Скотт открыл необходимые формулы, позволяющие трансформировать излучение. Они были переданы его коллеге из альтернативной реальности, но их использование для передачи на USS Enterprise привело к тому, что он застрял в водопроводной трубе, ведущей к турбине.( Star Trek )

    Транспортировка "почти деформированная" также была возможна, но потребовала значительных изменений в процедуре транспортировки. Он включал в себя подачу энергии транспортным кораблем на свои транспортеры в то время, когда он выпадал из варпа на время, достаточное для передачи материального потока. После этого корабль немедленно прыгнет обратно в варп.

    Люди, испытавшие этот вид транспорта, впоследствии отметили, что было краткое ощущение слияния с неодушевленным предметом, прежде чем луч транспортера снова собрал их.

    Транспортировка, близкая к деформации, также упоминается как "деформация касанием и движением вниз". (TNG: "Шизоидный человек")

    Скорость выше деформации

    В 2374 году персонал Voyager успешно использовал транспортеры класса Intrepid , чтобы доставить выброшенных на мель членов экипажа USS Dauntless , когда оба корабля путешествовали в квантовом потоке. "Вояджер" во время транспортировки ускорился, следуя курсом преследования, минуя ограничения скорости, налагаемые динамикой поля варпа.(VOY: "Надежда и страх")

    Исходя из даты запуска Voyager , предположительно, немодифицированный транспортер Mark VII использовался для транспортировки с квантовыми скоростями скользящего потока.

    Излучение и вещества

    Некоторые формы радиации и вещества, обычно минералы, такие как кельбонит, препятствовали работе транспортеров. В большинстве случаев помеха была вызвана рассеянием кольцевого ограничивающего луча или помехой датчика, препятствующей блокировке транспортера.Помехи могут быть естественными или искусственными и обычно возникают при транспортировке с поверхности на звездолет, но могут также возникать между судами. Примеры других ограничений излучения и веществ:

    В сценарии DS9: «Эмиссар» Сиско предположил Майлзу О'Брайену, что он сам и его сын Джейк могли бы светить на борту космической станции Deep Space 9, если бы они знали, что управление воздушными шлюзами станции в то же время было проблематичным. . Однако, по словам О'Брайена, использование транспортных систем объекта «было бы невозможно» из-за «паразитных ядерных выбросов», которые экипаж станции должен был отследить, прежде чем они смогут «безопасно возобновить работу транспортера»." [1]

    Устройства

    На протяжении веков было разработано множество устройств для преодоления некоторых ограничений транспортеров, в то время как другие использовались для преднамеренного вмешательства в работу транспортеров.

    Маркер-транспортер, данный Кире Нерис

    К 24-му веку использование усилителей рисунка стало обычным явлением на борту большинства кораблей Звездного Флота, которые чаще всего отправлялись на поверхность планеты во время чрезвычайных ситуаций, когда транспортировка была критичной.

    Устройства, специально разработанные для блокирования сигналов транспортера или создания помех им, обычно развертывались во враждебных условиях, что делало использование транспортера невозможным или очень опасным и ограничивало маневренность персонала или материалов. Вот некоторые из этих устройств:

    В 2375 году Ведек Фала подарил полковнику Кире Нерис небольшой кристалл. Устройство неизвестного происхождения и конструкции на самом деле было транспортной меткой, которая мгновенно перенесла ее в Эмпок Нор, находящийся на расстоянии нескольких световых лет.(DS9: «Завет»)

    Кроме того, в 2293 году Спок использовал пластырь с виридиумом, чтобы найти и зафиксировать капитана Кирка и доктора Маккоя на Руре Пенте. Хотя это не устройство-транспортер, оно использовалось для определения местонахождения объекта с помощью транспортера. ( Звездный путь VI: Неизведанная страна )

    Транспортировка раненых

    Хотя кого-то с легкими травмами можно было перевезти, это было невозможно, когда травмы были обширными. Когда ствол мозга был поврежден и вегетативные функции перестали работать, транспортировка была возможна только в том случае, если доброволец контролировал вегетативные функции человека.Это было сделано путем размещения нервной подушки у основания черепа обоих людей и последующего соединения обоих людей с помощью медицинского трикодера. Таким образом, вегетативные функции могут быть стабилизированы на короткий период времени, что сделает возможной транспортировку. (ТНГ: "Преображения")

    В 2372 году Одо начал испытывать на себе воздействие неизвестного недуга, который он получил от своих товарищей-подменышей, что привело к дестабилизации его молекулярной структуры. Когда было предложено переправить его на борту USS Defiant на новую родину Основателей, экипажу пришлось ждать, пока Одо перенесет себя на борт корабля.Когда его спросили, почему он не может пройти через транспортер, доктор Джулиан Башир объяснил, что « его молекулярная структура уже достаточно зашифрована, « добавил: » [t] последнее, что ему нужно, это поездка через буфер транспортера. "(DS9:" Broken Link ")

    Специальные операции

    Автоматический возврат

    Начиная с 2269 года, транспортеры могли быть настроены на автоматическую отправку сообщений человеку по прошествии заранее оговоренного времени. В 2269 году Джеймс Т. Кирк попросил Монтгомери Скотта установить автоматический возврат на десять минут.(ТАС: "Терратинский инцидент")

    Отключение активного оружия

    К 24 веку транспортер имел возможность отключать любое активное оружие во время транспортировки. Это могло быть достигнуто путем удаления разряженной энергии из сигнала транспортера или путем «деактивации» самого оружия. Система транспортера включала подпрограммы деактивации оружия для управления процессом. (TNG: «Самые игрушки», «Загнанные», «Негодяи»)

    Транспортер также был способен полностью удалять оружие во время транспортировки, что в Звездном Флоте именуется «Пятый Транспортный Протокол».Когда Defiant поднялся на борт выживших с поврежденного корабля Джем'Хадар, транспортер был запрограммирован на удаление дизрапторов экипажа и другого оружия. (ДС9: "Насмерть")

    Фальсифицирующая дезинтеграция с помощью фазера

    Хотя транспортировка обычно занимала несколько секунд, можно было доставить человека в безопасное место за доли секунды до того, как он будет поражен лучом фазера, создавая впечатление, будто они распались. К 2373 году Секция 31 имела доступ к такой технологии и использовала ее, чтобы инсценировать смерть оперативника Лютера Слоана перед Постоянным комитетом Ромулана.Поскольку Уильям Росс позже сказал Джулиану Баширу, что глава Тал Шиара Коваль выстрелил в Слоана из фазера, а не из дизрапторного пистолета, вполне вероятно, что оружие было специально модифицировано и было неотъемлемой частью создания иллюзии. (DS9: "Inter Arma Enim Silent Leges")

    Соединение двух транспортеров

    Два транспортера можно соединить вместе с помощью системной блокировки, чтобы облегчить прямую транспортировку между ними. С помощью этого суда Федерации могли дистанционно активировать транспортеры других судов Федерации.Это означало, что два транспортера можно было соединить друг с другом, чтобы обеспечить передачу излучения в ситуациях, когда в противном случае это было бы невозможно из-за ионных или каких-либо других помех. (TNG: «Симбиоз», «Царство страха»)

    Сначала необходимо было установить удаленное соединение с другим транспортером, затем задействовать системную блокировку и синхронизировать буферы шаблонов обоих транспортеров. Когда катушки фазового перехода находились в режиме ожидания, могла начаться подача питания.

    Побочным эффектом использования этого вида транспорта для передачи ионного излучения через ионную интерференцию было то, что человек, на которого было направлено излучение, мог почувствовать легкое покалывание из-за статического электричества.(TNG: "Царство страха")

    Внутрикорпусное излучение

    В середине 60-х годов прошлого века направить луч с площадки транспортера на место внутри того же судна было очень рискованным делом. Ограничения технологии в то время делали весьма вероятным, что любая ошибка приведет к повторной материализации объекта внутри переборки, палубы или другой конструкции. Таким образом, процедура предпринималась редко. (TOS: «День голубя») Впервые эта процедура была использована без происшествий столетием раньше.(ЛОР: «Избранный мир»)

    Причина трудностей с внутрикорпусным излучением не указана. Технология, способная транспортировать объект на тысячи километров без ошибок , должна легко сделать это на несколько десятков метров, хотя можно предположить, что излучатели сфокусированы вдали от корабля, как показано в технических руководствах.

    С точки зрения написания самого эпизода, однако, если бы такая возможность действительно существовала, тогда было бы легко освободить захваченных членов экипажа на нижних палубах.

    В 2364 году командир Уильям Т. Райкер и лейтенант Таша Яр использовали внутрикорпоративное излучение во время спасательных операций. Когда на борту появился груз, а не пассажиров, Райкер приказал Яру перенести груз в трюм, не задумываясь. (TNG: "Симбиоз")

    Внутрисудовые перевозки, очевидно, были и безопасными, и обычными к 2360-м годам, поскольку, помимо вышеупомянутого примера, этот метод неоднократно использовался на борту корабля USS Enterprise -D:

    Транспорт «Зона-Зона»

    Излучение прямо в лазарет

    Самый ранний известный пример транспортировки с места на место, осуществленный персоналом Федерации, произошел в 1986 году, хотя транспортер находился на борту судна, которое возвращалось в прошлое с 2286 года.Корабль, который обладал возможностями связи между объектами, был клингонским по происхождению, но был украден экипажем последнего звездолета Enterprise . ( Star Trek IV: The Voyage Home )

    По крайней мере, к 2268 году ограничения в буфере шаблонов и технологии сканирования наведения были в достаточной степени преодолены, так что теперь появилась возможность перемещаться из одного места напрямую в другое без необходимости повторно материализовать объект между ними. (TOS: «Часть действия») В 24 веке эта операция была включена и контролировалась блокировками межсетевого транспорта.(TNG: "Братья")

    Клингонский транспортер выполняет транспортировку от места к месту.

    Системы транспортировщика нужно было вручную настроить для подготовки к транспортировке с места на место. Это включало сброс элементов управления буфером шаблонов и проверку сканеров наведения. (ВОЙ: "Скрученный")

    Транспортировка между сайтами удерживала материальный поток в буфере шаблонов, пока ACB был перенаправлен. После этого материальный поток был перенаправлен в новое место, и была проведена обычная рематериализация.

    Используя этот метод, любой компьютерный терминал, имеющий доступ к подсистемам главного транспортера, или любую применимую подпрограмму, можно использовать для управления операциями транспортера, включая терминалы моста. Этот метод можно было использовать только тогда, когда у транспортеров было достаточно энергии; все обычные ограничения перевозчика будут по-прежнему применяться. ( Звездный путь Немезида )

    Эта процедура была особенно полезна в экстренных случаях, когда время имело значение.Субъектов можно было направить прямо в лазарет, где можно было быстро провести лечение. (TNG: "Гобелен"; Star Trek: First Contact )

    В 2368 году прапорщик Уэсли Крашер использовал этот метод в попытке обогнать тех (особенно Райкера и Ворфа), чьи умы были захвачены ктарианской игрой. (TNG: "Игра")

    Семь из Девяти однажды инициировали транспортировку с места на место в кварталы Чакотая. Вместо звука дверных колокольчиков слышен сигнал связи (не свисток боцмана.) Она думает, что было бы неуместно видеть, как несут цветы в каюту первого офицера (ВОЙ: «Финал»).

    След транспортера

    К 23 веку стало обычной практикой хранить «след транспортера» (сохраненную копию молекулярного паттерна субъекта, сканированную во время обычного цикла транспортера). Хотя обычно он хранился в целях безопасности, в экстремальных ситуациях транспортер можно было модифицировать для использования более старого шаблона трассировки вместо последнего сканирования с целью перенастройки потока материи во время молекулярного преобразования, эффективно заменяя объект на объект. младшая версия самой себя при переконструировании материи.Первое известное использование этой техники было в 2270 году, когда она была использована для восстановления экипажа USS Enterprise , старение которого было обращено вспять, до их взрослых версий. (ТАС: «Инцидент с часами») Еще одно заметное использование следа транспортера было в 2364 году, чтобы восстановить капитана Жан-Люка Пикарда после неудачной попытки инопланетного энергетического существа слиться с ним. (TNG: «Одинокие среди нас»)

    Сам след транспортера регулярно хранился в течение всего срока службы; когда этого человека переназначили, его след был удален.(TNG: "Неестественный отбор")

    При необходимости ДНК человека можно использовать для создания следа переносчика. Эту технику использовали шеф Майлз О'Брайен и лейтенант Джорди Ла Форж во время миссии на Дарвинской станции генетических исследований в 2365 году.

    Следы Transporter также использовались в качестве медицинского инструмента для выявления аномалий на молекулярном уровне. Сравнивая следы идентификатора транспортера Динны Трой, Дейта и Майлза О'Брайен до и после того, как они были захвачены преступниками из Укс-Маль, доктор Беверли Крашер смогла обнаружить, что их нервная система вырабатывала высокие уровни синаптической и анионной энергии.(TNG: «Power Play») Другой пример такого применения был в 2373 году, когда Доктор использовал записи следа транспортера Гарри Кима, чтобы определить, когда он был заражен тарезианской ДНК. (ГОЛОС: "Любимый сын")

    Отклонение балки транспортера

    Луч транспортера может быть отклонен тяговым лучом в разные координаты, так что транспортируемые объекты рематериализуются в точке, отличной от предполагаемых координат цели. Такое действие можно было обнаружить только при просмотре журнала транспортера.В эмиттерной катушке будет присутствовать необычное количество частиц антигравитона, поскольку эти частицы не возникают в природе, а используются тяговыми лучами. Определить координаты, в которых произошла рематериализация, было невозможно; однако было возможно вычислить точку происхождения самого притягивающего луча. (TNG: "Прикреплено")

    Индивидуальный транспорт

    Транспортер можно запрограммировать так, чтобы разрешить перевозку только одного конкретного человека на площадку транспортера и обратно.Запрограммированный таким образом, никто другой не мог использовать транспортер. Если использование транспортера было дополнительно запрещено из-за использования неизвестного кода доступа, использование транспортера было почти невозможно.

    Единственный способ обойти эту блокировку - использовать трассировку транспортера от человека, который перепрограммировал транспортер, и ввести его в транспортер, пока он находился в режиме тестирования. В режиме тестирования транспортер принимает смоделированные входные данные. Когда главный компьютер не мог использоваться, несколько трикодеров можно было объединить в сеть для управления транспортером.Чтобы обойти блокировку, потребовались коды доступа от нескольких офицеров на мостике, чтобы заставить его вернуться в цикл. Следовательно, любой и каждый, кто транспортировал, будет рассматриваться транспортером как человек, который перепрограммировал его в первую очередь. (TNG: "Братья")

    Имитация аварии с транспортером

    Аварию транспортера можно было сфальсифицировать таким образом, чтобы начальник перевозчика подумал, что человек погиб во время перевозки. Например, это можно сделать, настроив несущую волну второго транспортера на несущую волну первого.Затем человек будет излучать первый транспортер, в то время как второй транспортер излучает небольшое количество генетически идентичного материала.

    Только врач мог определить, действительно ли этот материал был тем человеком, о котором идет речь. След транспортера можно использовать для сравнения зарегистрированного «следа» ДНК с «мертвым» человеком. Однобитовые ошибки могут быть обнаружены, если тиражировался «мертвый» материал.

    Только транспортеры, работающие на той же частоте подпространства, что и фальшивый транспортер, могут использоваться для этого типа уловки.Например, на это были способны некоторые ромуланские транспортники.

    Еще одним показателем такой уловки может быть временное увеличение отношения материи к энергии во время транспортировки. Однако это увеличение может находиться в пределах номинальных рабочих параметров рассматриваемого транспортера. Исследование журналов транспортера было бы необходимо, чтобы найти доказательства второго сигнала транспортера. (TNG: "День данных")

    Аварийное массовое излучение

    Некоторые транспортеры могли перевозить большое количество людей и рематериализовать их одновременно или группами.Однако из соображений безопасности это делалось нечасто. В 2268 году экипаж USS Enterprise использовал свои транспортеры таким образом, чтобы захватить членов экипажа клингонского корабля. В 2377 году USS Voyager перевез более двухсот клингонов с линейного крейсера, увеличив его буферную емкость. (TOS: «День Голубя»; VOY: «Пророчество»)

    Узкая ограничивающая балка

    Установка узкой ширины кольцевого ограничивающего луча транспортера иногда позволяет ему проникать через некоторые типы защиты или другие помехи.Одним из примечательных применений этого метода было проникновение через щиты боргов, процедура, разработанная учеными Магнусом и Эрин Хансен. (ВОЙ: "Темный рубеж")

    Скелетный замок

    USS Voyager Главный инженер Б'Эланна Торрес изобрела экстренную меру захвата луча транспортера на минералы в скелетной системе цели, чтобы обеспечить транспортировку, когда биознаки не могут быть обнаружены с точки происхождения. Это позволяло перебрасывать персонал обратно на корабль, даже если обычные средства блокировки транспортера выходили из строя.Она придумала это после того, как обычный сигнальный замок не сработал, во время аварийного выхода луча из куба Борга в 2373 году (VOY: «Скорпион»).

    Использование в нападении

    В 2373 году Найрианцы использовали дальнобойный транспортер, чтобы взять под контроль USS «Вояджер », передавая лучи на борт корабля по одному человеку за раз, заменяя при этом члена экипажа. Изначально симулируя невежество и замешательство, найрианцы не вызывали подозрений до тех пор, пока не превзошли по численности экипаж Voyager .К тому времени, однако, было уже слишком поздно; Найрианцы захватили «Вояджер » и заключили команду в симулированную земную среду на борту огромного тюремного корабля. Позже выяснилось, что это была часто используемая найрийская стратегия, поскольку она была гораздо менее затратной, чем участие в открытых боевых действиях. (ВОЙ: "Перемещенный")

    В 2374 году пираты с помощью транспортеров украли главный компьютер корабля USS Voyager и другое критически важное оборудование, в результате чего вооружение, навигация и двигательная установка корабля вышли из строя.Это привело к тому, что Том Пэрис заметил: « Я чувствую, что нас только что ограбили. » (VOY: «Относительно полета»)

    Вулкан Чу'лак модифицировал метательное оружие, добавив микротранспортер, позволяющий стрелять пулями через стены в другие комнаты. (DS9: "Поле огня")

    Медицинский транспорт

    Согласно аудиокомментариям DVD к фильму Star Trek , в ранних набросках этого фильма транспортер сыграл роль в рождении Джеймса Т.Кирк, хотя это также привело бы к другой потере - в экстренной ситуации можно было вытащить ребенка из утробы, но, будучи «неточной наукой», это произошло ценой жизни матери. В то время как J.J. Абрамс подумал, что это «действительно крутая» идея, что технология может быть использована таким образом, план был отклонен, потому что производственный персонал не хотел вводить транспортер так рано в фильме, и чувствовал, что конец такого Травматическая начальная сцена нуждалась в «победе» выживания Вайноны Кирк.

    Рематериализация без одежды

    Просвечивается их платьями

    Во время карьеры Чакотая в Звездном Флоте он попал в аварию на транспортере. Его форма оказалась в буфере выкройки; он материализовался, одетый только в свой гребень. (ВОЙ: "Во плоти")

    Снять одежду с помощью транспортера также можно намеренно, как это сделала группа ференги с Диной и Льваксаной Трои в 2366 году. (TNG: «Ménage à Troi»)

    Прочие операции

    Приложения

    Справочная информация

    Истоки

    Транспортер был разработан производственным персоналом оригинальной серии как решение того, как быстро вывести членов экипажа с планеты.Единственной альтернативой было либо высаживать массивный корабль каждую неделю, либо регулярно использовать шаттлы для посадки, и то и другое нанесло бы ущерб производственному бюджету. ( Энциклопедия Звездного пути (3-е изд., Стр. 519)) Хотя оба они были предложены в первоначальном наброске схемы сериала, Звездный путь - это ... (с регулярными посадками шаттлов и редкими спусками корабля) , редакция того же документа (перепечатанная в The Making of Star Trek , pp. 22–30) содержала один из первых примеров, в которых была изложена концепция транспортера.([3]; The Making of Star Trek , p. 26) В описании постулировался еще не названный «скремблер энергии-материи, который может« материализовать »[десантные группы] на поверхность планеты». Далее в схеме говорилось: « Это требует максимальной мощности луча и является огромным расходом энергии для крейсера. Это можно сделать только на относительно коротких расстояниях прямой видимости. таким образом, но требуют менее критических затрат энергии. "( The Making of Star Trek , p.26)

    Джин Родденберри считал изобретение транспортера очень удачным и «одним из многих случаев, когда компромисс вынудил нас к творческой мысли и фактически улучшил то, что мы планировали сделать». Далее он объяснил: « Если бы кто-то сказал:« Мы дадим вам бюджет на приземление корабля », наши истории начались бы медленно, слишком медленно [....] Принятие транспортного средства [...] позволило Мы, чтобы хорошо погрузиться в историю, по второй странице сценария. "( The Making of Star Trek , стр.43–44)

    В сценарии «Клетка», первого пилотного эпизода Star Trek , транспортер упоминается как состоящий из устройства, доминирующего в транспортной комнате, и «может быть кошмарной концепцией футуристического рентгеновского аппарата для художника. «а также« застекленную камеру транспортера », над которой зависало устройство.

    Изображение транспортера в TOS: "The Man Trap" сыграло важную роль в том, что этот выпуск стал первым, когда-либо транслировавшимся. Хотя сценарист «Человеческой ловушки» Джордж Клейтон Джонсон тогда не знал об этом, Херб Солоу сообщил ему, спустя годы, о важности транспортника для того, чтобы убедить руководителей NBC сначала транслировать «Человеческую ловушку».Джонсон передал: « Он сказал мне:« Пойдя с твоим, мы смогли открыть сериал, в котором экипаж садится на борт транспортного средства и смотрит на планету. Позволяя аудитории наблюдать за транспортным средством в действии и позволяя им увидеть, как команда материализуется и дематериализуется, мы были избавлены от необходимости пытаться это объяснить ». "( Джордж Клейтон Джонсон - Художник ," Star Trek ")

    В ранней написанной версии TOS: «Из чего сделаны маленькие девочки?» Транспортер был описан как «скремблер энергетической материи» (в соответствии с тем, как он был охарактеризован в вышеупомянутом исправленном проекте Star Trek... ). Однако в серии исследовательских заметок (от 11 мая 1966 г.) Келлам де Форест указал: « 'Scramble' подразумевает, что объекты перемешаны неорганизованным образом. Транспортер преобразует материю тела в энергию. В результате де Форест предложил вместо этого называть транспортер «преобразователем энергии».

    Артур Сингер, редактор рассказов третьего сезона TOS, имел некоторую неуверенность в отношении функции транспортера, которую он выразил примерно через три месяца после Д.К. Фонтана покинул сериал в качестве редактора рассказа. Относительно того, как Сингер выразил свое недоумение по поводу устройства, Фонтана вспоминает: « [Он] забрел на площадку и спросил нашего декоратора:« Кстати, а что этот транспортер снова делает? » "

    В руководстве для писателей серии (третья редакция от 17 апреля 1967 г.) говорилось о транспортном средстве: « Его дальность действия ограничена примерно 16 000 миль. » [4]

    Руководство сценаристов / режиссеров для Star Trek: Phase II содержало точно такое же утверждение.( Star Trek Phase II: The Lost Series , стр. 96) Для этой серии в мост Enterprise должна была быть включена «транспортная станция» вместе с работающим транспортным средством. ( Star Trek Phase II: The Lost Series , стр. 20) Он должен был служить транспортером оборудования для передачи на мост таких вещей, как небольшие инструменты. (текстовый комментарий, Star Trek II: The Wrath of Khan (The Director's Edition) DVD) 13 октября 1977 года Джин Родденберри заявил, что транспортеры Phase II смогут проходить через силовое поле Enterprise . когда он был полностью поднят, открыв часть силового поля, чтобы сделать его слабым или умеренным.( Star Trek Phase II: The Lost Series , стр. 50) Однако в руководстве для сценаристов / режиссеров серии пояснялось, что транспортер Enterprise не может работать, пока работает дефлекторный экран корабля. ( Star Trek Phase II: The Lost Series , стр.97)

    Джин Родденберри вкратце рассмотрел - рано утром, в то время как Star Trek: The Next Generation находился в стадии подготовки - значительно увеличив мощность транспортера в The Next Generation до такой степени, что не могло быть показано ни одного главного звездолета. в этой серии.Это необычное предложение было отменено к концу обеда того же дня. ( Star Trek: The Next Generation - The Continuing Mission 1-е изд., Стр. 14) Дэвид Герольд возражал против него, указывая, что Enterprise был необходимо для успеха Star Trek , потому что корабль был «звездой шоу». Герольд добавил: « Он говорит:« Хорошо. Просто выбрось это ». "( Stardate Revisited: The Origin of Star Trek - The Next Generation, Part 1: Inception , TNG Season 1 Blu-ray special features) Также во время разработки TNG некоторое внимание уделялось возможности использования транспортера на мосту Galaxy класса , хотя вскоре от этой идеи отказались в пользу турболифтов.( Starlog , выпуск № 125, стр. 46) Поскольку Дэвид Герольд перечислил (в своей книге The World of Star Trek [номер страницы? • редактировать] ) неисправности транспортера как слишком часто используемые сюжетные устройства в В оригинальном сериале Родденберри намеревался исправить это в TNG. ( Звездный путь - Куда никто не ушел раньше, , издание в мягкой обложке, стр. 110)

    Концептуальный эскиз транспортера DS9, сделанный Рикардо Дельгадо.

    Транспортер и термин «луч» были настолько относительно легко объяснены, что они были одной из множества причин, по которым Рик Берман и Майкл Пиллер решили, что их попросили выпустить новый научно-фантастический сериал. create, который в конечном итоге стал Star Trek: Deep Space Nine , будет в форме Star Trek , а не в совершенно новом шоу.Поскольку конструктивные параметры серии были очень хорошо определены, установка транспортера для Звездного Флота на космическую станцию ​​Deep Space 9 оказалась «совсем несложной», по словам художника-постановщика Германа Циммермана. Транспортер в операционном центре станции был спроектирован Рикардо Ф. Дельгадо и проиллюстрирован им в концептуальном эскизе. ( The Official Star Trek: Deep Space Nine Magazine issue 3, p. 6) Создатели тогда еще нового шоу решили полагаться на тот факт, что транспортеры уже были созданы ранее во франшизе Star Trek Мы не будем изобретать транспортер заново - все знают, как работает транспортер, нам больше не нужно объяснять это, », - заявил Циммерман. ( Trek: Deepspace Nine , стр. 52)

    Концепция дальнего транспортера снова была кратко рассмотрена при начальной разработке заключительного эпизода TNG «Все хорошее ...». Однако сцену, в которой он должен был быть использован, вскоре пропустили. ( Star Trek: The Next Generation Companion (3-е изд., Стр. 301))

    Транспортер изначально не планировался для включения на борт Defiant класса , который был представлен в начале третьего сезона DS9.Однако на каком-то этапе Герман Циммерман ожидал, что, как того требовали истории и бюджет, позже к классу Defiant будут добавлены транспортные средства. ( Cinefantastique , Vol. 27, No. 4/5, p. 97) Транспортёр для этого класса действительно был создан по проекту Джима Мартина. ( The Art of Star Trek , стр. 112) Он дебютировал в третьем сезоне «Прошедшее время, часть I».

    В то время как Star Trek: Enterprise находился в разработке, исполнительный продюсер Браннон Брага изначально хотел, чтобы на Enterprise NX-01 не было транспортера, хотя эта идея оспаривалась руководством Paramount.« [Он] думал, что транспортная технология - это будущее, », - объяснил Андре Борманис, говоря о точке зрения Браги. " Ну [...] это стало предметом спора с, вы знаете, сильными мира сего. Мы пришли к компромиссу, так что, хорошо, у него есть транспортер, но это экспериментальная технология, и они на самом деле не хотят использовать его, если в этом нет крайней необходимости. И мы думали, что в 22 веке это должно быть более сложным, или еще лучше, давайте не будем вводить его в первом сезоне.Может, во втором сезоне обновят корабль. "(" Смело идти: запуск Enterprise , часть I: обратный отсчет ", особенности Blu-ray сезона 1 для ЛОР)

    Еще более ранний транспортер должен был быть изображен в фильме Star Trek Beyond для судна 22-го века USS Franklin . Дуг Юнг, соавтор сценария фильма, однажды прокомментировал: « В то время у них на самом деле не было транспортеров людей, вы не могли направить человека наверх. Поэтому нам пришлось вставить строку, где Скотти говорит:« Я сделал эти перекалибровки.' "[5]

    Наборы и реквизит

    «Психоделическая» задняя стенка транспортера TOS была фактически сделана из светоотражающего полупрозрачного пластика, известного музыкантам как «Drum Wrap», поскольку он обычно используется для украшения внешних цилиндров барабанных установок. Позже тот же пластик стал использоваться в домофонах, которые регулярно показывались на Star Trek: Enterprise . (Текстовый комментарий "Стигма", DVD-диск 2-го сезона ЛОР)

    Транспортер TOS имел «встроенную верхнюю и нижнюю подсветку для эффектов свечения вверх / вниз», - заявил Роберт Джастман.( Star Trek: The Magazine Volume 1, Issue 17, p. 13) Подушечки транспортера от TOS были простыми линзами Френеля. Джон Дуайер, декоратор, работавший как над TOS, так и над TNG, объяснил: « В оригинальной серии светильники на платформе под круглыми кольцами представляли собой изогнутые линзы, отполированные таким образом, чтобы сделать свет действительно ярким, как будто у вас есть маяки; но они также используют их в более крупных сценических огнях, и это то, чем они были. "( Star Trek: The Magazine Volume 2, Issue 12, p.25) (См. Это воссоздание Вспышки из сцены, удаленной из «Женщин Мадда», для указания яркости линзы Френеля мощностью 10 000 ватт.) Эти компоненты были единственной частью транспортного набора, который остался, когда набор был перепроектирован для Star Trek: The Motion Picture . (аудиокомментарий, Star Trek: The Motion Picture (Blu-ray)) Следующее поколение также использовало линзы в качестве элементов потолка непосредственно над подушками. ( Искусство Звездного пути , стр.78) Двайер вспоминал: « [Художник-постановщик] Герман [Циммерман] сказал:« Эй, это хорошая идея; давайте просто оставим это! » Так мы и сделали. "( Star Trek: The Magazine Volume 2, Issue 12, p. 25) Те же компоненты были дополнительно включены в транспортер USS Voyager в Star Trek: Voyager . ( The Art of Star Trek , стр. 78) Майкл Окуда вспоминал: « Однажды, я думаю, во время Voyager я работал на подиуме над съемочной площадкой и смотрел на эти линзы.Пять из них выглядели пожелтевшими и потрескавшимися, так что я считаю, что они были из оригинальной серии. Один из них выглядел намного новее. "(аудиокомментарий, Star Trek: The Motion Picture (Blu-ray))

    Транспортер оборудования, предложенный для моста Enterprise из Star Trek: Phase II , был фактически построен. Один из остатков его конструкции, квадрат из четырех зеленых огней, был включен в мост Enterprise из Star Trek II: The Wrath of Khan .В транспортном средстве Regula I в этом фильме использовались прожекторы, отражающиеся от блестящего шара позади съемочной площадки - простой способ добиться эффекта энергетических узоров на задней стенке камеры транспортера. (текстовый комментарий, Star Trek II: The Wrath of Khan (The Director's Edition) DVD)

    Слабый узор на внутренней стороне транспортера TNG был вдохновлен свитером, принадлежащим Герману Циммерману, который создал узор во время подготовки TNG. Заинтересованный в чем-то отличном от психоделических муаровых паттернов транспортера оригинальной серии, но которому не понравились ни один из паттернов, которые он или его сотрудники разработали для потенциального использования, разочарованный Циммерман наконец снял свой свитер и заявил: « Вот, это это то, что мы будем использовать! "Шаблон был впоследствии включен в конструкцию транспортера Enterprise -D, который был повторно использован в качестве транспортера Enterprise -A в Star Trek V: The Final Frontier и Star Путь VI: неизведанная страна .(текстовый комментарий, Star Trek VI: The Uniscovered Country (Special Edition) DVD)

    Для Star Trek Generations транспортер Enterprise -D получил новую схему внутреннего освещения, которая включала добавление янтарных гелей позади некоторых верхних линз транспортера от TOS. ( The Art of Star Trek , стр. 278) Поскольку оригинальные панели задней стенки транспортера TNG каким-то образом были повреждены во время подготовки к съемке фильма, они были заменены новыми, но практически идентичными панелями.(текстовый комментарий, DVD Star Trek Generations (Special Edition))

    По крайней мере одна из панелей пола транспортера Enterprise -D была повторно использована в качестве подноса в баре Quark's Bar, Grill, Gaming House и Holosuite Arcade в Star Trek: Deep Space Nine . ( Secrets of Quark's Bar , особенности DS9 Season 1)

    Набор транспортеров класса Intrepid , созданный для Star Trek: Voyager

    Согласно Star Trek: Communicator , транспортер класса Intrepid включал в себя «вертикальное оргстекло с боковой подсветкой и остроконечную звуковую пену на стенах. ."( Star Trek: Коммуникатор , выпуск 111, стр. 52) По словам актера Кима Гарретта Ванга, потолок транспортера Intrepid класса , использованный на съемочной площадке Star Trek: Voyager , был оригинальным потолком, использовавшимся в Star Trek. : Кинофильм . ( E! Inside Star Trek: Voyager , на 21 минуте)

    Пол и потолок транспортера на борту самолета Enterprise класса NX были вдохновлены линзами Френеля TOS. (Текстовый комментарий «Сломанный лук», DVD-диск 1-го сезона ЛОР) Точно так же стороны транспортера ЛОР сознательно напоминали стены транспортера TOS Enterprise .( Сломанный лук , издание в мягкой обложке, стр. 268)

    Спецэффекты
    Наследие

    Транспортер - единственная технология, которая обычно используется в постановке Star Trek , но которую Андре Борманис, по крайней мере, с 1996 года, считал "настоящей натяжкой" воображения. « Принцип неопределенности Гейзенберга делает невозможным знание точного местоположения и энергии какой-либо конкретной субатомной частицы. Следовательно, если бы вы разобрали человека, как это делает транспортер, возможно, будет невозможно снова собрать их вместе, » он объяснил.« У нас есть основания полагать, что это происходит из-за некоторых очень простых физических фактов о Вселенной, и обойти это невозможно. » ( Captains 'Log Supplemental - The Unauthorized Guide to the New Trek Voyages , p. 76)

    Хотя крылатая фраза « Beam me up, Scotty » вошла в поп-культуру, сама точная фраза никогда не произносилась в Star Trek . ( Star Trek Encyclopedia (? Ed., P.?)) Наиболее близкое использование этой фразы появилось в Star Trek IV: The Voyage Home , когда Кирк просит: « Скотти, просвети меня. «Точно так же в« По этой стороне рая »Кирк заявляет:« Поднимите меня, мистер Спок. «Только в двух других случаях использовались безоговорочные ссылки на фразу« Beam me up »-« Сквайр Готоса »и« Стрела времени ».

    По словам Майкла ДеМеритта, исполнители, которые изображали людей, которых просвечивали лучи, часто были в восторге от этого. Он заявил: « Это мечта каждого актера, кто бы ни попал на Star Trek .« Пожалуйста, просияйте меня ». »(ЛОР: аудиокомментарий« Полярная звезда », DVD-диск 3-го сезона ЛОР) Ветеран Star Trek Актер Вон Армстронг назвал транспортер своей« любимой частью техники Trek »и сказал:« Я не могу вспомнить ничего лучше. «Точно так же, когда Пэт Таллман спросили, какая у нее любимая технология из франшизы, она включила в свой ответ риторический вопрос:« Кто не желает транспортера? "( Star Trek Monthly , выпуск 90, стр. 31 и 32)

    Изначально знакомство с работой транспортера было проблемой для некоторых из главных актеров DS9. В результате, один из нескольких вопросов, которые актеру О'Брайена Колму Мини задали его коллеги по DS9, у него было больше опыта Star Trek , чем у них, сыграв О'Брайена в качестве повторяющегося персонажа в TNG, был: « Как работает ли луч вниз? "( The Official Star Trek: Deep Space Nine Magazine issue 1, p.23)

    Однажды актер Джейк Сиско Сиррок Лофтон с удовольствием ознакомился не только с транспортером, но и с наборами TNG и DS9. « Там никого не было. Итак, я начал возиться с вещами и сиять, », - вспоминал он. ( The Official Star Trek: Deep Space Nine Magazine issue 5, p. 49)

    Браннон Брага считал, что использование транспортера в ЛОР: «Точка исчезновения» для объяснения галлюцинаций было «большим поворотом».«Однако некоторые фанаты сочли это« отговоркой », по словам Браги. ( Star Trek: Communicator , выпуск 145, стр. 26)

    В Star Trek Adventure , где добровольцы были выбраны из аудитории, была оптическая иллюзия с использованием искажения линзы для имитации транспортера, который затем был отредактирован в видео для покупки после шоу.

    Апокриф

    В Миры Федерации (стр. 16), первая транспортировка Человека, как говорят, произошла в транспортной комнате авианосца USS Москва .

    Частичное объяснение разницы между транспортерами между Star Trek и Star Trek: The Next Generation представлено в романе TNG Dark Mirror , где Enterprise -D встречается с зеркальной вселенной, где находится Империя Терран. продолжается в 24 веке; Обсуждая оригинальный кроссовер, шеф Майлз О'Брайен отмечает, что транспортеры в эпоху Кирка были существенно более мощными, но гораздо менее сложными, и людям не хватало знаний о том, как некоторые пространственные аномалии могут повлиять на систему, даже если их чистая мощность имела тенденцию компенсировать те недостатки.

    В экранизации романа «Сломанный лук» говорится, что до того, как глагол «луч» был принят для описания процесса транспортировки, Звездный флот рассматривал слова «схватка», «тепло», «разобрать, разобрать». «и» копье, хотя «луч» считался наименее устрашающим термином.

    В альтернативной реальности был разработан дополнительный элемент транспортной техники. Известный как «инженерный транспортный инструмент ( β )» или ETT, он состоял из винтовки, которая могла помечать объекты или людей и транспортировать их на короткие расстояния.В видеоигре Star Trek 2013 года Джеймс Т. Кирк и Спок используют этот инструмент, чтобы обойти области звездной базы Frontier, которые были повреждены атакой Горна.

    Маркировка Спока с помощью ETT

    Рематериализация Спока на другой стороне заблокированной двери

    Внешние ссылки

    Чувствительный к жасмонату транспортер GTR1 необходим для опосредованного гиббереллином развития тычинок у Arabidopsis.

    Количественная ОТ – ПЦР.

    Суммарная РНК была выделена из указанных растительных материалов с использованием системы выделения общей РНК SV (Promega KK, Токио, Япония).Суммарную РНК (400 нг) преобразовывали в кДНК с использованием PrimeScript RT Enzyme Mix I, Oligo dT Primers и случайных 6-меров в соответствии с протоколом набора для синтеза 1-й цепи кДНК PrimeScript (TaKaRa, Shiga, Япония). Количественную ОТ-ПЦР проводили с 8,0 нг кДНК в конечном объеме 20 мкл в соответствии с инструкциями SYBR Premix Ex Taq II (TaKaRa, Shiga, Japan). Количественную ОТ-ПЦР выполняли в системе термоциклера Dice Real Time System II (TaKaRa, Шига, Япония). Данные были нормализованы к данным для WT, подвергнутого ложному лечению.Ген полиубиквитина UBQ10 At4g05320 (ссылка 41) использовали в качестве контрольного гена. Условиями термоциклирования были: начальная денатурация при 95 ° C в течение 30 с, затем 40 циклов по 5 с при 95 ° C и 30 с при 60 ° C. Для каждого эксперимента использовали три биологические повторы. Использовались следующие праймеры: UBQ10 ( At4g05320 ) прямой 5'-GGCCTTGTATAATCCCTGATGAATAAG -3 ', обратный 5'-AAAGAGATAACAGGAACGGAAACATAGT -3'; GTR1 ( At3g47960 ) qPCR прямой 5'- GTCCATTGGCTGGTATTGCT -3 ', обратный 5'- ACTTGCTGCAACGTGCATAG -3'; PDF1.2 ( AT5G44420 ) прямой 5'- TTTGCTGCTTTCGACGCAC -3 ', обратный 5'- CGCAAACCCCTGACCATG -3'; MYC2 ( AT1G32640 ) прямой 5'- CGGCTACAACCAACGATGAA -3 ', обратный 5'- CCGGAGGCCATAAAGTTGAG -3'; ERF1 ( AT3G23240 ) прямой 5'- ACGATCCCTAACCGAAAACAGA -3 ', обратный 5'- GTGAGAAGCCGGAGAATGG -3'; ORA59 ( AT1G06160 ) прямой 5'- GGCTCTCGCTTATGATCAGG -3 ', обратный 5'- CCGGAGAGATTCTTCAACGA -3'; LOX3 ( AT1G17420 ) прямой 5'- CACTGCAATTCACAAGCAACC -3 ', обратный 5'- CAAAGGAGGAATCGGAGAAGC -3'; AOS ( AT5G42650 ) прямой 5'- GCGACGAGAGATCCGAAGA -3 ', обратный 5'- CTCGCCACCAAAACAACAAA -3'; DAD1 ( AT2G44810 ) прямой 5'- GTGAAGACGAAGAAGAAGAGCAATC -3 ', обратный 5'- GTGAAGACAGCGAAAACGACATAC -3'; OPR3 ( AT2G06050 ) прямой 5'- TTGGACGCAACTGATTCTGAC -3 ', обратный 5'- GTAGGCGTGGTAGCGAGGTT -3'; SEN4 ( AT4G30270 ) прямой 5'- GACTCTTCTCGTGGCGGCGT -3 ', обратный 5'- CCCACGGCCATTTCCCCAAGC -3'; SAG12 ( AT5G45890 ) прямой 5'- GGCGTTTTCAGCGGTTGCGG -3 ', обратный 5'- CCGCCTTCGCAGCCAAAATCG -3'; SAG18 ( AT1G71190 ) прямой 5'- GTTTGCGAGGTGAGAAAATAGGA -3 ', обратный 5'- AGAGTAGCATCGTTTGGGTGAAG -3'; SAG20 ( AT3G10985 ) прямой 5'- TCGGTAACGTTGTTGCTGGA -3 ', обратный 5'- ACCAAACTCTTTCAAATCGCCA -3'.

    Генотипирование и анализ экспрессии растений с нокаутом Т-ДНК.

    Мутанты со вставкой Т-ДНК на фоне Col-0 были получены из Центра биологических ресурсов Arabidopsis: gtr1 , (CS879742). Генотипический анализ проводили с помощью ПЦР. Использовали следующие праймеры: GTR прямой 5'-ATGGAGAGAAAGCCTCTTG -3 ', обратный 5'-TCAGACAGAGTTCTTGTCT -3'; LB3 5'-TAGCATCTGAATTTCATAACCAATCTCGA -3 '. Для получения растений 35S: GTR1 / gtr1 последовательность GTR1 амплифицировали с помощью ДНК-полимеразы PrimeSTAR HS (TaKaRa, Shiga, Япония) из кДНК, созданной с использованием набора для РНК-ПЦР (TaKaRa, Shiga, Япония) и Gateway-совместимого праймеры (прямой 5'- GGGGACAAGTTTGTACAAAAAAGCAGGCTACACC -3 ', обратный 5'- GGGGACCACTTTGTACAAGAAAGCTGGGGTATCAGACAGAGTTCTTGTCT -3').Продукты ПЦР клонировали в pDONR / Zeo с помощью набора Gateway BPII (Life Technologies, MD, США), и последовательности проверяли. Конструкции GTR1 использовали в реакциях LR Gateway (Life Technologies, MD, USA) в комбинации с бинарными векторами экспрессии pGWB2 (ссылка 42), а затем проверяли секвенированием. Полученную конструкцию затем трансформировали в gtr1 с использованием метода окунания в цветочек, опосредованного Agrobacterium tumefaciens, 43 .

    Экспрессионный анализ выполняли с помощью полуколичественной RT – PCR.Для ОТ-ПЦР общую РНК выделяли с использованием системы выделения общей РНК SV (Promega KK, Токио, Япония), кДНК генерировали с помощью набора для РНК-ПЦР (TaKaRa, Shiga, Япония) и проводили ПЦР. Actin2 ( AT3G18780 ) использовали в качестве эталонного гена 41 . Использовали следующие праймеры: GTR1 ( AT3G47960 ) ОТ-ПЦР, прямой 5'-ATGGAGAGAAAGCCTCTTG -3 ', обратный 5'-TCAGACAGAGTTCTTGTCT -3'; Actin2 ( AT3G18780 ) прямой 5'- ACATTGTGCTCAGTGGTGGA -3 ', обратный 5'- TCATACTCGGCCTTGGAGAT -3'.

    Химические реактивы

    ТА синтезировали, как описано ранее. (-) - MeJA получали из коммерчески доступного рацемического MeJA в соответствии с предыдущим методом 44,45 . Озонолиз олефиновой части в (-) - MeJA, реакция Виттига и последовательное снятие защиты дали TA 46 .

    (-) - JA-L-Ile был синтезирован по предыдущей методике 47 . Вкратце, рацемический MeJA был связан с L-Ile. После снятия защиты смесь диастереомеров разделяли хроматографией на колонке с силикагелем, получая (-) - JA-L-Ile.

    (±) -JA, MeJA, ABA, GA 3 были приобретены в Вако, Осака, Япония. Также коммерчески доступны 4-метилтиобутилглюкозинолат (ChromaDex, Калифорния, США), GA 1 , GA 4 , GA 8 , GA 9 и GA 20 (Olchemim, Olomouc, Чешская Республика).

    Условия роста растений

    Для анализа экспрессии генов использовали 10-дневные проростки. От десяти до пятнадцати семян инкубировали в колбе Эрленмейера на 100 мл с 30 мл жидкой среды MS, содержащей 1% сахарозы, при постоянном освещении (20–36 мкмоль м –2 с –1 ) при встряхивании (130 об.вечера.). Растения обрабатывали 20 мкМ MeJA или / и 20 мкМ GA 3 и собирали в указанные моменты времени. Для обработки CHX растения обрабатывали 100 мкМ CHX в течение 1 ч перед обработкой гормоном. Растительные материалы замораживали в жидком азоте и хранили при -80 ° C до использования. Для проверки чувствительности к MeJA мы использовали 4-недельные проростки, выращенные на среде MS, содержащей 50 мкМ MeJA, 0,8% агара и 1% сахарозы, при постоянном освещении (30–55 мкмоль м –2 с –1 ). Мы также использовали те же экспериментальные условия для измерения длины корня растений, обработанных 20 мкМ MeJA.Для измерения длины корня мы разместили пластины в вертикальном положении. Мы сфотографировали корни и измерили длину корня с помощью программного обеспечения ImageJ (http://rsbweb.nih.gov/ij) 48 . Для взрослых растений проростки, выращенные на среде MS, содержащей 0,8% агара, переносили в почву и выращивали до зрелости при 22 ° C при постоянном освещении. Для анализов гормональной комплементации почки взрослых растений обрабатывали 50 мкМ GA, 50 мкМ MeJA или 50 мкМ JA-Ile каждые 2 дня в течение 2 недель.

    Гистохимический анализ

    Геномный фрагмент длиной 2000 п.н. непосредственно перед стартовым кодоном GTR1 амплифицировали с помощью ПЦР с использованием праймеров (прямой 5'- TGATTACGCCAAGCTTGGTTCTTAGACTGGCGAG -3 '-3' -TTTTTTTTGACTGGCCAAGTC clCTGCAGCCAAGTC 'затем в вектор pCambia1391Z.Полученную конструкцию затем трансформировали в Columbia-0 с использованием метода окунания в цветочек, опосредованного Agrobacterium tumefaciens 43 . Окрашивание GUS проводили в течение 16 ч с 2 мМ X-Gluc (5-бром-4-хлор-3-индолил-β-D-глюкуронид), 0,5 мМ K 4 Fe (CN) 6 , 0,5 мМ K 3 Fe (CN) 6 , 0,3% (об. / Об.) Tween20 и 50 мМ NaPO 4 , pH 7,4. Реакцию останавливали, и растения обесцвечивали в 70% этаноле 49 . Для анализа гормонального ответа растения обрабатывали 20 мкМ MeJA или 0.02% этанола за 3 ч до окрашивания GUS. Для срезов ткани окрашенные GUS цветки фиксировали в течение ночи в растворе FAA (5% об. Формалина, 5% об. Уксусной кислоты, 45% об. Этанола) при 4 ° C.

    Фиксация образцов проводилась как описано 50 с небольшими изменениями. Образцы обезвоживали серией этанола, а затем этанол заменяли смесью, содержащей раствор Technovit 7100 (Heraeus Kulzer, Токио, Япония) и отвердитель I (Heraeus Kulzer, Токио, Япония). Образцы заливали смесью, содержащей раствор отвердителя II (Heraeus Kulzer, Токио, Япония), раствор Technovit 7100 и отвердитель I.Образцы были нарезаны на срезы толщиной 6 мкм. Мы сфотографировали срезы образцов, и цветовой баланс изображений был скорректирован с помощью программного обеспечения ImageJ 48 .

    Характеристика транспортера GTR1 с использованием ооцитов

    Xenopus

    Кодирующая последовательность GTR1 была амплифицирована с помощью праймеров (прямой 5'- TATTAAGCTTGAATTCATGAAGCAGAGTCATTCT -3 ', обратный 5'- CGACTCCCGGGGAATTCTConedTAG11 и субконтракт сайт плазмиды, который ранее использовался для экспрессии AtHKT1 (ref.51). GTR2 амплифицировали с праймерами (прямой 5'- AAGCTTGAATTCCCCGGGATGGAGAGAAAGCCTCTTG -3 ', обратный 5'- GGATCCGTCGACCCCGGGTCAGGCAACGTTCTTGTCT -3') и субклонировали в сайт SmaI . NPF4.1 амплифицировали с праймерами (прямой 5'-AAGCTTGAATTCCCCGGGATGCAGATTGAGATGGAAG -3 ', обратный 5'- GGATCCGTCGACCCCGGGCTAATATCTTTTCGCCCAG -3') и субклонировали в сайт SmaI . Комплементарную РНК с кэпом (кРНК) каждого гена получали с использованием набора mMESSAGE mMACHINE (Life Technologies, MD, США).Подготовку ооцитов и инъекцию кРНК выполняли, как описано 51 . В каждый ооцит вводили 500 нг кРНК. После инкубации в течение 24 или 48 ч буфер заменяли 100 мкл раствора на основе кулори 51 (90 мМ глюконат натрия, 1 мМ глюконат калия, 1 мМ глюконат кальция, 1 мМ глюконат магния, 1 мМ LaCl 3 и 10 мМ MES, pH 5), содержащего соответствующий субстрат (субстраты), и ооциты инкубировали в течение дополнительных 24 часов. Для определения значений K m через 24 часа после инъекции кРНК два ооцита обрабатывали субстратом GA 3 (1, 10, 30, 60, 100, 300, 1000 и 2000 мкМ) в буфере на основе Кулори. (pH 5) и инкубировали при 17 ° C в течение 24 часов.

    Подготовка образцов для жидкостной хроматографии / масс-спектрометрии

    Ооциты дважды промывали 200 мМ раствором сорбита, гомогенизировали в 40 мкл экстракционного буфера (28% метанол, 0,05% уксусная кислота) и инкубировали при 4 ° C в течение 24 часов. После центрифугирования (20000 г , комнатная температура, 20 мин) супернатанты собирали, и образцы объемом 10 мкл подвергали ультраэффективной жидкостной хроматографии в сочетании с анализом времяпролетной масс-спектрометрии (UPLC / TOFMS).

    UPLC / TOFMS анализ

    UPLC / TOFMS анализ 10 мкл образцов экстрактов ооцитов выполняли с использованием Agilent 1290 Infinity (Agilent Technologies, Калифорния, США), соединенного с microTOF II (Bruker Daltonics, Лейпциг, Германия).Колонку ZORBAX Eclipse Plus C18 (1,8 мкм, 2,1 × 50 мм; Agilent Technologies) использовали для разделения субстратов. Подвижными фазами были: A, 20% (об. / Об.) Водный метанол с 0,05% (об. / Об.) Уксусной кислоты, и B, метанол с 0,05% (об. / Об.) Уксусной кислотой. Программа градиента была: от 0 до 3,5 мин, изократический 90% A; От 3,5 до 6 мин, линейный градиент от 90 до 0% A; От 6,1 мин до 9 мин, изократический 90% A, со скоростью потока 0,15 мл мин. -1 . Масс-спектрометр работал в отрицательном режиме с диапазоном сканирования 100–700 м / z .Напряжение на капилляре составляло 4200 В, давление газа в распылителе составляло 1,6 бар, расход газа для десольватации составлял 8,0 л мин -1 , а температура составляла 180 ° C. Количество субстратов определяли на основе хроматограммы экстрагированных ионов и соответствующего положения пика стандартного раствора.

    Слияние EGFP и субклеточная локализация

    Стоп-кодон GTR1 был мутагенизирован с помощью ПЦР для введения в сайт SalI с праймерами (прямой 5'- TACAATTACAGTCGACATGAAGAGCAGAGTCATTCT -3 ', обратный 5'- ATCCTCTACGAGTCGTC).Затем этот сайт использовали для создания слитой конструкции GTR1-EGFP в рамке. Конечная конструкция, 35S: GTR1-EGFP -pUC18, и пустой вектор, 35S: EGFP -pUC18, временно экспрессировались в эпидермальных клетках лука с использованием системы, опосредованной пушкой частицами (PDS-1000 / He; Bio- Рад, Калифорния, США). Облученные клетки хранили в темноте при 22 ° C в течение 12 ч с последующим формированием изображений GFP с использованием конфокальной микроскопии (Leica; DM2500).

    Прорастание пыльцы

    in vitro

    Эксперимент по прорастанию пыльцы in vitro проводили, как описано 52 с небольшими изменениями.Для WT и gtr1 цветки стадии 14 случайным образом собирали с восьми растений каждое. Затем для каждого эксперимента пыльцевые зерна получали от трех отдельных цветков. Среда для прорастания пыльцы содержала 5 мМ MES-Tris (pH 5,8), 1 мМ KCl, 0,8 мМ MgSO 4 , 1,5 мМ борную кислоту, 10 мМ CaCl 2 , 16% (мас. / Об.) Сахарозы и 0,5% (w / v) INA-агар. Прорастание пыльцы наблюдали под микроскопом после 24 ч инкубации при 23 ° C в непрерывном свете (30 мкмоль м -2 с -1 ) с высокой влажностью, и подсчитывали количество проросших пыльцевых зерен.

    Количественная оценка гормонов растений

    Стадии развития цветков были такими, как описано 35 . Цветы были разделены на три стадии (12–14) и собирались каждые 3 дня с 4-6-недельных растений, выращенных на почве. Образцы цветов (~ 500 мг свежей массы на этап) замораживали в жидком азоте и хранили при -80 ° C. Замороженные образцы из WT и gtr1 лиофилизировали, и GA экстрагировали из образцов с использованием 80% (об. / Об.) Ацетона, содержащего 1% (об. / Об.) Уксусной кислоты, как описано 53 .Вкратце, лиофилизированные растительные материалы (12–28 мг сухого веса) измельчали ​​в 80% (об. / Об.) Ацетоне, содержащем 1% (об. / Об.) Уксусной кислоты с [17,17- 2 H 2 ] GA ( 300 пг каждый) в качестве внутренних стандартов. Неочищенный экстракт очищали с помощью картриджей с поливинилпирролидоном (500 мг; Tokyo Kasei) и с обращенной фазой (Oasis HLB, 60 мг; Waters). Фракцию, содержащую GA, дополнительно очищали с помощью ионообменной колонки (Bond Elut DEA, 100 мг; Agilent) и картриджа с силикагелем SepPak (100 мг; Waters). Полученную фракцию, обогащенную GA, концентрировали досуха, растворяли в 20 мкл воды, содержащей 1% уксусную кислоту, и затем подвергали анализу масс-спектрометрии LC-тандем (LC-MS / MS).

    GA были определены количественно, как описано 53 с некоторыми модификациями. ЖХ проводили с колонкой Acquity UPLC HSS T3 (1,8 мкм, 2,1 × 50 мм; Waters, MA, USA) с использованием следующей программы с растворителем A (вода, содержащая 0,01% (об. / Об.) Уксусной кислоты) и растворителем B (ацетонитрил). содержащий 0,05% (об. / об.) уксусной кислоты): изократический поток с 3% B в течение 30 с, линейный градиент B от 3 до 12% в течение 2,5 минут, линейный градиент B от 12 до 25% в течение 5 минут, линейный градиент B от 25 до 40% в течение 4 минут, изократический поток с 40% B в течение 2 минут, линейный градиент B от 40 до 98% в течение 1 минуты и изократическое элюирование с 98% B в течение 1 минуты.Условия МС / МС были следующими: плавающее напряжение ионного распыления (кВ) = - 4,0, температура десольватации = 600 ° C, энергия столкновения (В) = - 40 (GA 1 ) или -30 (GA 4 ), потенциал декластеризации = -90, переход МС / МС ( м / z ): 349,2 / 275,2 ([ 2 H 2 ] GA1), 347,2 / 273,2 (GA 1 ), 333,2 / 259,2 ( [ 2 H 2 ] GA 4 ), 331,2 / 257,2 (GA 4 ). Время удерживания LC составляло 5,5 мин для GA 1 и 11.5 мин для GA 4 .

    Транспортер ASCT1 (Slc1a4) является физиологическим регулятором d-серина и развития нервной системы головного мозга

    Значение

    d-серин регулирует синаптическую пластичность и поведение путем связывания с рецепторами NMDA. Перекрестное взаимодействие астроцитов и нейронов обеспечивает l-серин для синтеза d-серина в процессе, называемом сериновым челноком. Мы показываем, что нейтральный аминокислотный антипортер ASCT1 может высвобождать l-серин из астроцитов в обмен на d-серин и другие аминокислотные субстраты.Мыши, у которых отсутствует ASCT1, но не паралогичный ASCT2, демонстрируют измененные уровни в мозге l-серина, d-серина, l-аланина, l-треонина и глицина. Делеция ASCT1 была связана с уменьшением объема различных областей мозга, измененной экспрессией генов, а также с моторным и обучающим дефицитом. Наше исследование проливает свет на роль ASCT1 в метаболизме мозга с последствиями для патофизиологии нарушений развития нервной системы, наблюдаемых у пациентов с мутациями в гене ASCT1.

    Abstract

    d-серин является физиологическим коагонистом рецепторов NMDA, но мало что известно о регуляции его синтеза и синаптического обмена.Аминокислотные обменники ASCT1 (Slc1a4) и ASCT2 (Slc1a5) являются кандидатами на регулирование уровней d-серина. Используя мышей ASCT1 и ASCT2 KO, мы сообщаем, что ASCT1, а не ASCT2, является физиологическим регулятором метаболизма d-серина. ASCT1 является основной системой захвата d-серина в астроцитах и ​​может также экспортировать l-серин через гетерообмен, снабжая нейроны субстратом для синтеза d-серина. Мыши ASCT1-KO демонстрируют более низкие уровни d-серина в головном мозге наряду с более высокими уровнями l-аланина, l-треонина и глицина.Делеция ASCT1 была связана с нарушениями развития нервной системы, включая уменьшение объемов гиппокампа и полосатого тела, а также изменения экспрессии генов, связанных с развитием нервной системы. Кроме того, мыши ASCT1-KO проявляли дефицит двигательной функции, пространственного обучения и аффективного поведения, наряду с изменениями относительного вклада d-серина по сравнению с глицином в опосредование активности рецепторов NMDA. Микродиализ in vivo продемонстрировал более низкие уровни внеклеточного d-серина у мышей ASCT1-KO, подтверждая измененный метаболизм d-серина.Эти изменения напоминают некоторые фенотипы развития нервной системы у пациентов с мутациями ASCT1. Мыши ASCT1-KO представляют собой полезную модель для потенциальных терапевтических вмешательств, направленных на коррекцию метаболических нарушений у пациентов с мутациями ASCT1.

    NMDA-рецепторы (NMDAR) играют ключевую роль в развитии нервной системы, синаптической пластичности, обучении и памяти (1). В отличие от других рецепторов нейротрансмиттеров, NMDAR требует связывания коагониста (d-серина или глицина) в дополнение к глутамату (1).d-серин синтезируется из l-серина сериновой рацемазой (SR) (2). Мыши SR-KO обнаруживают снижение уровня d-серина в головном мозге на 90% и обнаруживают нарушения NMDAR-зависимой синаптической пластичности (3-5). Однако механизмы, регулирующие метаболизм d-серина в переднем мозге, остаются неизвестными. В ранних исследованиях сообщалось об исключительной астроцитарной локализации d-серина (6), что привело к предположению, что d-серин является глиотрансмиттером. Однако недавние исследования с использованием более селективных антител и SR-KO в качестве контроля показывают, что SR преимущественно экспрессируется нейронами (7-9).В соответствии с этим, избирательная делеция SR из нейронов снижает синаптическую пластичность в синапсах гиппокампа коллатерального CA1 Шаффера как in vitro, так и in vivo (5, 9).

    L-серин мозга синтезируется из глюкозы с помощью ряда ферментов, включая 3-фосфоглицератдегидрогеназу (3PGDH), которая экспрессируется исключительно в астроглии. Избирательная астроцитами делеция 3PGDH у мышей сильно снижает уровни нейронального d-серина (8). Эти данные привели нас к предложению метаболического перекрестного взаимодействия астроцитов и нейронов, называемого сериновым челноком, посредством которого l-серин, синтезируемый в астроцитах, перемещается к нейронам и поддерживает синтез d-серина (10).

    Обмениватели аланина, серина, цистеина и треонина ASCT1 (SLC1a4) и ASCT2 (SLC1a5) транспортируют d-серин в трансфицированных клетках HEK293 (11). ASCT2 имеет более широкую субстратную селективность, действуя также на глутамин (12). Однако их значимость для транспорта d-серина или других аминокислот мозга in vivo не оценивалась.

    Для идентификации транспортеров l- и d-серина в астроцитах и ​​изучения их роли in vivo мы исследовали мышей ASCT1-KO и ASCT2-KO. Мы обнаружили, что ASCT1, а не ASCT2, является компонентом серинового челнока мозга.Мыши ASCT1-KO обнаруживают двигательные нарушения и нарушения развития нервной системы, напоминающие миссенс-мутации ASCT1 у людей. Данные указывают на роль ASCT1 в метаболическом взаимодействии астроглии и нейронов и развитии нервной системы.

    Результаты

    Роль ASCT1 и ASCT2 в транспорте аминокислот.

    Мы создали колонии мышей ASCT1-KO и ASCT2-KO и изучили их роль в транспорте аминокислот в головном мозге. Гомозиготы ASCT1-KO и ASCT2-KO жизнеспособны и плодовиты. У мышей ASCT1-KO не было обнаруживаемого белка ASCT1 в головном мозге ( SI Приложение , рис.S1). Поскольку экспрессия ASCT2 в головном мозге ниже аффинности нашего антитела, мы подтвердили отсутствие критических экзонов ASCT2 в мозге мышей ASCT2-KO с помощью ПЦР, наряду с отсутствием экспрессии белка в почках, где ASCT2 высоко экспрессируется. ( SI Приложение , рис. S1).

    Мы наблюдали снижение на 80–90% транспорта d-серина и l-серина в культивируемых астроцитах мышей ASCT1-KO (рис. 1 A и B ). Транспортировка типичных субстратов ASCT1 (например,g., l-аланин и l-треонин) также значительно снизился (рис. 1 C и D ). Кроме того, транспорт глицина астроцитами ASCT1-KO был на 40% ниже, чем WT (фиг. 1 E ), в то время как поглощение глутамата не изменилось (фиг. 1 F ).

    Рис. 1.

    Транспорт аминокислот астроглией мышей ASCT1-KO и ASCT2-KO. ( A - H ) Поглощение аминокислот в первичных культурах астроцитов мышей WT и ASCT1-KO, проведенное в забуференном Hepes физиологическом растворе (HBSS) с добавлением 10 мкМ d- [ 3 H] серина ( A ), l- [ 3 H] серин ( B ), l- [ 14 C] аланин ( C ), l- [ 3 H] треонин ( D ), [ 3 H] глицин, ( E ) или 1- [ 3 H] глутамат ( F ).( G и H ) Поглощение 10 мкМ d- [ 3 H] серина ( G ) или [ 3 H] глицина ( F ) измеряли в HBSS с добавлением 14 мкМ аланина. , 36 мкМ l-серина, 2 мкМ цистеина и 18 мкМ треонина (A, S, C, T). ( I - L ) Поглощение аминокислот в первичных культурах астроцитов мышей WT и ASCT2-KO в HBSS с добавлением 10 мкМ d- [ 3 H] серина ( I ), l- [ 3 H] серин ( J ), 1- [ 3 H] глутамин ( K ) или 1- [ 3 H] глутамат ( L ).Результаты представляют собой среднее значение ± SEM от четырех до семи экспериментов с различными препаратами астроглии. Отличается от контроля при *** P <0,001, ** 0,01 и * 0,05 (парный двусторонний тест Стьюдента t ). нс, разница несущественная.

    В физиологических условиях другие внеклеточные аминокислотные субстраты могут связываться с ASCT1 с высоким сродством и предотвращать транспорт d-серина. Поэтому мы протестировали поглощение d- [ 3 H] серина в присутствии типичных внеклеточных концентраций субстратов ASCT1 [14 мкМ l-аланина, 36 мкМ l-серина, 2 мкМ l-цистеина и 18 мкМ l- треонин (13)].В этих условиях ASCT1 все еще транспортирует d-серин (Fig. 1 G ). Напротив, ASCT1-зависимое поглощение глицина не было обнаружено в присутствии других субстратов ASCT1 (рис. 1 H ), что позволяет предположить, что глицин является плохим субстратом ASCT1.

    Однако поглощение d-серина, l-серина, l-глутамина и l-глутамата не изменилось в первичных культурах астроцитов мышей ASCT2-KO (рис. 1 I - L ).

    В корковых синаптосомах, состоящих из смеси нейрональных и глиальных частиц, мы обнаружили на 30% меньшее поглощение l-серина и d-серина в препаратах от мышей ASCT1-KO (рис.2 A и B ), процент, который представляет собой предполагаемое глиальное загрязнение в синаптосомном препарате (14). Мы также отслеживали эффект транс, -4-гидрокси-1-пролина (OH-Pro), селективного субстрата ASCT1, который конкурирует с другими субстратами (15). В соответствии с этим, OH-Pro ингибировал транспорт d-серина в HEK293, трансфицированном ASCT1, в той же степени, что и избыток l-аланина ( SI, приложение , рис. S2 A ). OH-Pro не влиял на ASCT2 или транспортер d-серина Asc-1 ( SI, приложение , рис.S2 B и C ). OH-Pro ингибировал захват d-серина (фиг. 2 B ) и l-серина (фиг. 2 A ) синаптосомами WT, но не влиял на препараты из ASCT1-KO. В отличие от ASCT1, поглощение типичных субстратов ASCT2 (например, глутамина, l-серина и d-серина) не затрагивалось в синаптосомах, полученных из мышей ASCT2-KO (рис. 2 D ).

    Рис. 2.

    Поглощение аминокислот в синаптосомах мышей ASCT1-KO и ASCT2-KO и изменения аминокислот в мозге.( A - C ) Поглощение аминокислот синаптосомами мышей WT и ASCT1-KO, отслеживаемых в HBSS с добавлением 1 мкМ d- [ 3 H] серина ( A ), l- [ 3 H ] серин ( B ) или 1- [ 3 H] глутамат ( C ) либо в отсутствие, либо в присутствии 1 мМ OH-Pro. ( D ) Поглощение аминокислот в синаптосомах мышей WT и ASCT2-KO. ( E ) Уровни аминокислот в цельном мозге мышей P4 WT ( n = 10) и ASCT1-KO ( n = 11).Результаты представляют собой среднее значение ± SEM четырех ( A и B ), пяти ( D ) и семи ( C ) экспериментов с различными препаратами. Отличается от контроля при *** P <0,001, ** 0,01 и * 0,05. n.s., разница незначительна. Повторные измерения одностороннего дисперсионного анализа с последующим апостериорным тестом Тьюки ( A - C ) или двусторонним тестом Стьюдента t ( D и E ).

    Аминокислоты мозга у мышей ASCT1-KO.

    Мы измерили уровни субстратов ASCT1 и ASCT2 в мозге соответствующих мышей KO и однопометников WT в разном возрасте. В мозге 4-дневных (P4) мышей ASCT1-KO обнаружено снижение уровней l- и d-серина на 20 и 25% соответственно (рис. 2 E ). Уровни глицина, l-треонина и l-аланина были на 60-40% выше у мышей ASCT1-KO, чем у мышей WT (рис. 2 E ). Небольшое снижение уровня l-глутамата мозга на 7% было также обнаружено у мышей ASCT1-KO. Примечательно, что соотношение между двумя коагонистами NMDAR (глицин / d-серин) в мозге мышей ASCT1-KO было почти вдвое больше, чем у мышей WT (1.9-кратное увеличение, P <0,001, непарный тест Стьюдента t ), что указывает на значительное увеличение общего глицина в головном мозге по сравнению с d-серином.

    Сывороточные уровни l-треонина у детенышей мышей P4 ASCT1-KO в два раза превышали значения WT ( SI, приложение , рис. S3 D ). Однако, за исключением этой незаменимой аминокислоты, сывороточные уровни других аминокислот у мышей P4 не коррелировали с их уровнями в мозге (сравните Рис.2 E и SI Приложение , Рис.S3 D ). Снижение уровней d-серина вместе с увеличением глицина, l-аланина и треонина сохранялось в некоторых областях мозга взрослых мышей ASCT1-KO ( SI, приложение , рис. S3 A - C ), тогда как их сывороточные аминокислоты не изменились ( SI Приложение , рис. S3 E ). Следовательно, изменения в развитии аминокислот мозга, наблюдаемые у мышей ASCT1-KO, обусловлены внутренними изменениями метаболизма мозга, не связанными с уровнями аминокислот в сыворотке.

    Уровни различных сфинголипидов, производных l-серина, в коре головного мозга и полосатом теле у мышей ASCT1-KO не были изменены ( SI Приложение , рис. S3 F и G ), что позволяет предположить, что поступление l- У взрослых мышей практически не влияло на синтез серина липидов.

    Однако мыши ASCT2-KO имели нормальные уровни аминокислот в мозге ( SI, приложение , рис. S4), что дополнительно указывает на то, что этот переносчик не влияет на метаболизм аминокислот в мозге мыши в нормальных условиях.Поэтому в последующих экспериментах мы сосредоточились на исследовании роли его паралога ASCT1.

    Астроглиальные локализации ASCT1.

    Экспрессия ASCT1 была продемонстрирована либо в астроцитах (16), либо преимущественно в нейронах (17). Чтобы определить локализацию ASCT1, мы провели иммуногистохимию с использованием мышей ASCT1-KO в качестве отрицательного контроля, чтобы гарантировать специфичность антител. Мы обнаружили, что ASCT1 колокализуется с астроцитарным маркером 3PGDH в коре головного мозга, области CA1 гиппокампа и зубчатой ​​извилине (рис.3 А ). Иммунофлуоресценция была отменена у мышей ASCT1-KO (фиг. 3 B ). Эксперименты по тройной иммунофлуоресценции показали отсутствие совместной локализации ASCT1 с клетками, экспрессирующими нейрональный маркер MAP2 (фиг. 3 C ). При большом увеличении пунктированная иммунореактивность ASCT1 наблюдается в телах клеток и астроглиальных отростках, где он колокализуется с 3PHGDH (рис. 3 C ). Данные показывают, что ASCT1 в основном является переносчиком астроцитов у взрослых мышей.

    Рис.3.

    Астроглиальная локализация ASCT1 у взрослых мышей. ( A ) Белок ASCT1 (красный) колокализуется с астроцитарным маркером 3PGDH (зеленый) у мышей WT, но не с нейрональным маркером белка, ассоциированного с микротрубочками 2 (MAP2). ( B ) Отсутствие иммунореактивности ASCT1 у мышей ASCT1-KO. ( C ) Большое увеличение кортикального астроцита, показывающего пунктированную иммунореактивность для ASCT1, который колокализуется с 3PGDH, но отсутствует в MAP2-экспрессирующих клетках. СА1, СА1 подполе гиппокампа; Сх, неокортекс; ДГ - зубчатая извилина; gr - гранулярные клетки; пи, пирамидальная ячейка.(Шкала 10 мкм.)

    Роль ASCT1 в нервном развитии.

    Мутации в ASCT1 вызывают микроцефалию у человека (18, 19). Используя МРТ, мы обнаружили значительное уменьшение объемов гиппокампа и полосатого тела мышей ASCT1-KO, что указывает на то, что они повторяют некоторые изменения, наблюдаемые у людей (рис. 4). Результаты полуавтоматического анализа были подтверждены ручным анализом гиппокампа ( SI Приложение , рис. S5). Никаких различий в объемах в неокортексе, коре мозжечка и в целом головном мозге не наблюдалось (рис.4 В ).

    Рис. 4.

    Объемы областей мозга и экспрессия генов у мышей ASCT1-KO. ( A ) Маскирование гиппокампа (красный) на среднем МРТ-сканировании населения дикого типа. ( B ) Общий объем мозга и субрегионов мышей WT соответствующего возраста 9–11 месяцев ( n = 12) и ASCT1-KO ( n = 12) мышей. ( C и D ) Графики разницы дельты (Log2) в экспрессии генов между мышами WT и ASCT1-KO (ось y ) и средних нормированных значений (ось x ), генерируемых в полосатом теле и неокортексе.Дифференциально экспрессируемые гены обозначены красными символами. ( E ) Анализ обогащения в метагруппах дифференциально экспрессируемых генов в полосатом теле мышей WT и ASCT1-KO в соответствии с биологическими процессами Gene Ontology, анализируемыми с помощью неизбыточной реципрокной связи генов и биологических терминов. На оси и показаны скорректированные значения P . Отличается от контроля при *** P <0,001 и ** 0,01. n.s., разница незначительна. Непарный двусторонний тест Стьюдента t ( B ).

    Затем мы провели секвенирование РНК полосатого тела, которое было изменено при МРТ-анализе, и сравнили его с неокортексом, который не был затронут. Мы обнаружили значительные изменения в 375 транскриптах в полосатом теле взрослых мышей при скорректированных значениях P ниже 0,05 (рис. 4 C и набор данных S1). Никаких изменений в экспрессии генов в неокортексе не наблюдалось (рис. 4 D ). В полосатом теле анализ обогащения с использованием неизбыточного реципрокного сцепления генов выявил 11 метагрупп, при этом преобладание генов, связанных с ведением аксонов и развитием нервной системы (рис.4 E и набор данных S2). Все метагруппы имели ширину силуэта> 0,5 (набор данных S2), что указывает на высокую степень внутренней герметичности и удаленности от других метагрупп (20). Наиболее значительные изменения были замечены в генах управления аксонами (рис. 4 E ), что свидетельствует об изменениях. в транскриптах генов, связанных с развитием нервной системы, у мышей ASCT1-KO.

    Изменения поведения у мышей ASCT1-KO.

    Мы наблюдали за двигательной функцией детенышей мышей на Р8, чтобы оценить раннюю дисфункцию. Паттерн передвижения мышей ASCT1-KO был таким же, как и у мышей WT, оба демонстрировали медленное ползание и некоторые асимметричные движения конечностей (рис.5 А ). Однако мыши ASCT1-KO демонстрировали замедленную реакцию выпрямления, когда их помещали на спину (фиг. 5 B ). При размещении на железной сетке, которую постепенно переворачивали, мыши ASCT1-KO падали под меньшими углами, что свидетельствует о более слабой силе захвата в четырех конечностях (рис. 5 C ). При подвешивании за задние лапы за край конической трубки детеныши мышей ASCT1-KO демонстрировали нормальную позу (рис. 5 D ), но демонстрировали более короткую задержку падения, что свидетельствует о более слабой силе задних конечностей (рис.5 E ).

    Рис. 5.

    Поведенческая характеристика мышей ASCT1-KO. ( A ) Оценка передвижения детенышей мышей P8 WT ( n = 42) и ASCT1-KO ( n = 19). ( B ) Время восстановления показывает большую задержку времени у мышей ASCT1-KO ( n = 19) по сравнению с мышами WT ( n = 42) P8 (** P <0,01). ( C ) Мыши ASCT1-KO ( n = 19) демонстрируют более слабый захват, чем WT ( n = 23) мыши P8 (** P <0.01). ( D ) Оценка подвешивания задних конечностей у мышей ASCT1-KO ( n = 19) и WT ( n = 42) мышей P8. ( E ) Мыши ASCT1-KO ( n = 19) демонстрируют более короткую задержку падения в тесте подвешивания задних конечностей по сравнению с мышами WT ( n = 42) P8 (*** P <0,001). ( F ) Снижение активности открытого поля у 4-месячных мышей ASCT1-KO (** P <0,01). ( G ) Характеристики стержня ротора мышей WT и ASCT1-KO (* P <0.05). ( H ) В задаче водного лабиринта Морриса мыши ASCT1-KO достигли платформы через более длительные периоды времени на 2 и 3 дни (** P <0,01), но достигли той же производительности, что и WT на 4 день. извлечение путем возврата платформы и воздействия на мышей одного и того же контекста на 50 и 51 день показывает идентичную производительность между мышами WT и ASCT1-KO. Пространственное обращение, проведенное на 52-54 дни, выявило значительно более длительную латентность у мышей ASCT1-KO (* P <0,05, ** P <0.01). ( I ) Мыши ASCT1-KO демонстрировали более медленное плавание в первые 3 дня фазы пространственного захвата, но не во время пространственного обращения (* P <0,05, ** P <0,01, *** P <0,001). Экспериментальные группы в F - I состояли из 4-5-месячных мышей-самцов (по 12 мышей в каждой группе). ( A - E ) Двусторонний тест Манна – Уитни U ; ( F - I ) непарный двусторонний тест Стьюдента t .

    Взрослые мыши ASCT1-KO демонстрируют некоторую степень двигательной дисфункции наряду с нарушениями в обучении и аффективной сфере. Взрослые мыши ASCT1-KO проявляли более низкую активность в открытом поле, но без значительных изменений во времени замораживания или попадании в центр (фиг. 5 F ). Мыши ASCT1-KO имели на 25% меньшую латентность падения со стержня ротора в первый день, что указывает на незначительное нарушение сенсомоторной координации, хотя они достигли такой же латентности, как у WT в последующих тестах (рис. 5 G ).При пространственном обучении с использованием водного лабиринта Морриса мышам ASCT1-KO потребовалось больше времени, чтобы узнать местоположение платформы (рис. 5 H , пространственное обнаружение). Однако после формирования сохранение пространственной памяти в ASCT1-KO было таким же, как и у мышей WT, что наблюдалось в испытании зонда ( SI Приложение , рис. S6 A и B ) и тесте восстановления памяти ( Рис.5 H ). Однако у мышей ASCT1-KO было значительно нарушено обращение пространственного обучения при изменении положения платформы (рис.5 H , пространственный разворот), что указывает на нарушение гибкости обучения. Скорость плавания взрослых мышей ASCT1-KO была на 25% ниже, чем у WT, что указывает на возможное нарушение моторики (рис. 5 I ). Однако низкая скорость плавания сама по себе не объясняет дефицит обучения. В день 1, несмотря на разницу в скорости плавания, мыши WT и ASCT1-KO достигли спасательной платформы после аналогичной задержки (рис. 5 H и I ). Кроме того, плавание мышей ASCT1-KO улучшилось в последующих испытаниях и было идентично плаванию мышей WT во время теста пространственного обращения (рис.5 I ).

    Зависимое от миндалевидного тела обучение страху, отслеживаемое с помощью теста активного двустороннего избегания, было нормальным у мышей ASCT1-KO ( SI Приложение , рис. S6 C ). Мыши ASCT1-KO демонстрировали 60% увеличение реакции испуга, которая, как известно, усиливается при тревоге ( SI, приложение , рис. S6 D ). Однако у мышей ASCT1-KO не было обнаружено изменений в предымпульсном ингибировании ( SI Приложение , рис. S6 E ), что указывает на интактное сенсомоторное управление.Тест предпочтения сахарозы показал снижение предпочтения через 72 часа ( SI, приложение , рис. S6 F ), но нормальное потребление жидкости ( SI, приложение , рис. S6 G ).

    Синаптическая активность у мышей ASCT1-KO.

    Долговременная потенциация (LTP) в синапсах Schaffer collateral-CA1 гиппокампа была нормальной у мышей ASCT1-KO ( SI Приложение , рис. S7 A ). LTP у животных WT не изменялся при добавлении субстрата ASCT1 OH-Pro ( SI, приложение , рис.S7 B ). Длительная депрессия, вызванная низкочастотной стимуляцией, была нормальной у мышей ASCT1-KO ( SI, приложение , рис.S7 C ). Не было обнаружено никаких изменений в базальной нейротрансмиссии или изолированных потенциалах NMDAR ( SI Приложение , рис. S7 D и E ).

    В свете их нормальной активности NMDAR, мы задались вопросом, могут ли более высокие уровни глицина в мозге у мышей ASCT1-KO компенсировать снижение d-серина (рис.2 E и SI, приложение , рис.S3 A - C ). Чтобы исследовать эту возможность, мы обработали срезы гиппокампа мышей WT и ASCT1-KO ферментом глициноксидазой (GO) для удаления глицина (6). Для повышения чувствительности метода мы использовали в 6-7 раз более низкое содержание ГО (в единицах активности), чем в предыдущих отчетах (6, 21). Использование ограниченного количества ГО позволяет только частичное удаление эндогенного глицина. В этом случае обработка GO, вероятно, будет менее эффективной для образцов, показывающих более высокие уровни глицина или повышенное высвобождение глицина.Мы обнаружили, что обработка низким титром ГО снижает экспрессию NMDAR-зависимого LTP от мышей WT почти на 50% ( SI, приложение , рис. S7 F ). На LTP в срезах мышей ASCT1-KO не влияла обработка низким титром ГО ( SI Приложение , рис. S7 G ), что позволяет предположить, что их более высокие уровни глицина могут превосходить ферментативную способность ГО. Кроме того, мы также отслеживали эффект ингибитора транспортера глицина 1 ALX 5407, который, как известно, увеличивает синаптический глицин (1).ALX 5407 увеличивал изолированные потенциалы NMDAR мышей WT и ASCT1-KO ( SI, приложение , рис. S7 H ). Однако степень стимуляции ALX 5407 была немного ниже в срезах от мышей ASCT1-KO по сравнению с контрольными животными WT ( SI Приложение , рис. S7 H ), что указывает на то, что NMDAR от ASCT1-KO могут быть немного более насыщенными глицин. Мы также исследовали клетки места в области CA1 мышей с помощью электрофизиологии in vivo, которая показала, что их активность сохраняется у мышей ASCT1-KO, за исключением значительных изменений ( SI, приложение , рис.S8).

    Аминокислотный обмен с помощью ASCT1 in vitro и in vivo.

    Чтобы исследовать способность ASCT1 высвобождать эндогенные аминокислоты, мы исследовали эффекты OH-Pro в острых срезах коры. Ожидается, что в качестве селективного субстрата ASCT1 OH-Pro будет обмениваться с внутриклеточными субстратами ASCT1. Перфузия OH-Pro вызвала высвобождение l-серина в срезах мышей WT, но не повлияла на высвобождение l-серина в срезах мышей ASCT1-KO (фиг. 6 A ). Эндогенные l-аланин и l-треонин также высвобождались OH-Pro в острых срезах (рис.6 B и C ). Хотя d-серин является подлинным субстратом ASCT1 для поглощения, добавление OH-Pro не вызывало высвобождения эндогенного d-серина, что указывает на то, что d-серин предпочтительно поглощается через ASCT1 (фиг. 6 D ). Точно так же OH-Pro не вызывал детектируемого высвобождения глицина (фиг. 6 E ).

    Рис. 6.

    ASCT1-опосредованный обмен аминокислот в срезах и микродиализ in vivo. ( A - E ) Выделение эндогенного l-серина ( A ), l-аланина ( B ), l-треонина ( C ), d-серина ( D ) и глицина. ( E ) получали перфузией срезов 1 мМ OH-pro в указанные моменты времени.Данные являются средними ± SEM семи экспериментов. Отличается от мышей ASCT1-KO при * P <0,05 и *** 0,001 (двухфакторный дисперсионный анализ с повторными измерениями и апостериорный тест Бонферрони). ( F - K ) Концентрации внеклеточных аминокислот в полосатом теле мышей в возрасте от 6 до 7 месяцев при микродиализе in vivo (12 мышей на группу). Данные представляют собой среднее значение ± SEM концентраций внеклеточных аминокислот, откалиброванных восстановлением in vivo. ** Отличается от WT при P <0.01, непарный двусторонний тест Стьюдента t . ( L ) Предлагаемая модель функции ASCT1 в сериновом челноке. Астроцитарный ASCT1 высвобождает l-серин, который впоследствии поглощается нейронами, чтобы подпитывать синтез d-серина SR. d-серин может высвобождаться нейронами через транспортер Asc-1 (Slc7a10) (26) и впоследствии поглощаться ASCT1 в астроцитах. l-аланин, l-треонин и d-серин могут служить внеклеточными субстратами, которые стимулируют экспорт l-серина через ASCT1 посредством гетерообмена.Нарушение транспорта l-серина у мышей ASCT1-KO может приводить к увеличению превращения l-серина в глицин ферментом серингидроксиметилтрансферазы (SHMT). Когда сериновый челнок нарушен, глицин, поглощаемый нейронами (пунктирная стрелка), может обеспечивать компенсаторный путь доставки l-серина в нейроны через нейрональный SHMT. Адаптировано с разрешения Servier Medical Art, https://smart.servier.com/.

    Впоследствии мы контролировали внеклеточные концентрации типичных субстратов ASCT1 с помощью микродиализа полосатого тела in vivo.Значения корректировались восстановлением in vivo путем инфузии аминокислот, меченных стабильными изотопами (22). Мыши ASCT1-KO демонстрировали 25% снижение стационарных внеклеточных уровней d-серина без изменения внеклеточных уровней l-серина (фиг. 6 F и G ). Кроме того, у мышей ASCT1-KO наблюдалось снижение соотношения внеклеточного d-серина / общего серина (фиг. 6 H ). Мы не обнаружили изменений внеклеточных концентраций аланина, треонина и глицина у взрослых мышей ASCT1-KO (рис.6 I - K ).

    Discussion

    Мы идентифицировали ASCT1 как важный переносчик d- и l-серина в астроцитах и ​​потенциальный игрок в сериновом челноке между глией и нейронами (Fig. 6 L ). ASCT1 - обязательный обменник, который демонстрирует более быструю кинетику, чем однонаправленные переносчики аминокислот (12). Его обменная активность, вероятно, будет способствовать достижению стационарного градиента концентрации через мембрану за счет увеличения скорости транспорта его субстратов.Это согласуется с нашими наблюдениями на первичных культурах астроцитов, синаптосомах и острых срезах головного мозга. Однако наши данные микродиализа in vivo показывают, что ASCT1 не изменяет абсолютные концентрации внеклеточных аминокислот в стабильном состоянии, за исключением d-серина. Внеклеточные уровни d-серина были на 25% ниже в полосатом теле мышей ASCT1-KO (фиг. 6 G ). Снижение внеклеточного d-серина согласуется с более низкими уровнями общего d-серина в головном мозге у молодых и взрослых мышей ASCT1-KO (рис.2 и SI Приложение , рис. S3 A - C ).

    Мы предполагаем, что ASCT1 осуществляет двунаправленный транспорт всех своих нейтральных аминокислотных субстратов, кроме d-серина (рис. 6 L ). Хотя ASCT1 катализирует высвобождение ранее загруженного d- [ 3 H] серина из клеток (11), активация гетерообмена ASCT1 с помощью OH-Pro в острых кортикальных срезах не высвобождает эндогенный d-серин. Этот результат согласуется с предыдущими исследованиями, демонстрирующими гораздо более низкие уровни эндогенного d-серина в астроцитах по сравнению с нейронами (5, 7⇓⇓ – 10).Вероятно, низкие количества d-серина в цитозоле астроцитов ниже сродства ASCT1.

    Снижение как общего, так и внеклеточного уровней d-серина, наблюдаемое у мышей ASCT1-KO, предполагает частичное нарушение продукции d-серина в головном мозге. L-серин, производимый в астроцитах, по-видимому, перемещается к нейронам, чтобы подпитывать синтез d-серина в процессе, называемом сериновым челноком (рис. 6 L ) (10). Несмотря на то, что внеклеточный l-серин не изменился у взрослых мышей ASCT1-KO, наши наблюдения, что мыши ASCT1-KO испытывают дефицит в транспорте l-серина, подразумевают, что уравновешивающая природа транспортера ASCT1 необходима для обеспечения достаточного количества l-серина для d-серина. синтез в локальных контактах между астроцитами и нейронами (рис.6 L ). Дальнейшие доказательства, подтверждающие роль ASCT1 в сериновом челноке, получены из наших открытий, демонстрирующих значительное снижение как l-серина, так и d-серина в головном мозге мышей ASCT1-KO P4 (Fig. 2 E ). Однако микродиализ in vivo был непрактичным у детенышей мышей P4, где изменения в l-серине и других субстратах ASCT1 были более заметными, чем у взрослых мышей (сравните Рис. 2 E и SI Приложение , Рис. S3). Наши данные, однако, не исключают, что другие транспортеры l-серина могут частично компенсировать отсутствие ASCT1 у мышей KO.Другие компоненты серинового шаттла, такие как система нейронального захвата l-серина, еще предстоит идентифицировать.

    В отличие от d-серина, уровни сфинголипидов, производных l-серина, были нормальными у мышей ASCT1-KO. Это может быть связано с высоким сродством серинпальмитоилтрансферазы (SPT), ключевого фермента биосинтеза сфинголипидов. SPT имеет в 30 раз более высокое сродство к l-серину ( K m ∼ 0,3 мМ) (23) по сравнению с ферментом биосинтеза d-серина SR ( K m ∼ 10 мМ) (10) .Следовательно, низкое сродство SR к l-серину делает синтез d-серина особенно чувствительным к нарушениям серинового челнока.

    Наше исследование также раскрывает роль ASCT1 в метаболизме аланина, треонина и глицина, поскольку их общие уровни в мозге увеличиваются у мышей ASCT1-KO. Известно, что астроциты осуществляют метаболизм аланина в лактат (24), тогда как треонин является незаменимой аминокислотой, которая достигает головного мозга через гематоэнцефалический барьер. Вероятно, недостаточный транспорт аланина и треонина у мышей ASCT1-KO частично нарушит их метаболизм в астроцитах и ​​приведет к их накоплению.Однако глицин является плохим субстратом ASCT1 (рис. 1 H ). Более высокие уровни глицина у мышей ASCT1-KO могут быть следствием нарушения транспорта l-серина. Недостаточный обмен l-серина в астроцитах ASCT1-KO может способствовать превращению l-серина в глицин с помощью фермента серингидроксиметилтрансферазы (рис. 6 L ).

    Интересно, что наши результаты с использованием как ферментативного удаления эндогенного глицина, так и ингибитора транспорта глицина предполагают более высокую занятость NMDAR глицином у мышей ASCT1-KO.Поскольку глицин также является регулятором синаптических NMDAR (4, 11, 21), более высокая занятость глицина может помочь сохранить NMDAR, как мы обнаружили у мышей ASCT1-KO. Более того, более высокий уровень глицина в головном мозге может обеспечивать компенсаторный механизм для преодоления нарушений в сериновом шаттле, поскольку глицин, высвобождаемый из астроцитов, может поглощаться нейронами и впоследствии превращаться в l-серин (рис. 6 L , пунктирная линия). Будущие исследования потребуются для уточнения точной роли ASCT1 в метаболизме аланина, треонина и глицина.Наше исследование также не предоставляет информации о роли ASCT1 в транспорте цистеина. Хотя l-цистеин является субстратом для ASCT1 in vitro, почти весь внеклеточный цистеин присутствует в форме цистина, который импортируется в клетки специальным переносчиком цистина / глутамата (25).

    Наше открытие нижних объемов полосатого тела и гиппокампа у мышей ASCT1-KO, связанных с изменениями в экспрессии генов, связанных с развитием нервной системы, частично повторяет некоторые из изменений нервного развития у пациентов с мутациями в транспортере ASCT1 (18, 19).Мы обнаружили, что мыши ASCT1-KO также демонстрируют двигательные нарушения и поведенческие дефициты при обучении и аффективных тестах. Мыши ASCT1-KO продемонстрировали нарушение пространственного обучения в водном лабиринте Морриса, что нельзя объяснить исключительно их более низкой скоростью плавания. Хотя мыши ASCT1-KO демонстрировали меньшие объемы гиппокампа, обширная электрофизиология ex vivo и in vivo не выявила дисфункции гиппокампа в наших условиях записи. Вполне вероятно, что комбинированные нарушения двигательной функции (напр.g., более низкая скорость плавания, активность открытого поля и латентность в стержне ротора) наряду с изменениями в аффективном поведении (более низкое предпочтение сахарозы и возможное беспокойство, что выявляется более высокой реакцией испуга), возможно, способствовали нарушению обучаемости в воде Морриса. лабиринт.

    Фенотипические отклонения у мышей ASCT1-KO отличаются от фенотипических отклонений у мышей SR-KO, у которых в основном отсутствует d-серин (3). Мыши SR-KO имеют нормальную двигательную функцию, неизменную реакцию вздрагивания и отсутствие признаков нарушения обучения в водном лабиринте Морриса.Следовательно, двигательные нарушения и нарушения обучения, наблюдаемые у мышей ASCT1-KO, вероятно, являются результатом комбинации дефицита d-серина с более широким метаболическим изменением аминокислот, которые мы описали здесь, включая аланин, треонин и глицин. В этой связи мыши ASCT1-KO будут полезны для разработки терапевтических вмешательств для предотвращения или уменьшения нарушений развития нервной системы у пациентов с мутациями в ASCT1.

    Материалы и методы

    Животные.

    Slc1a4 tm1e (KOMP) Мыши Wtsi (ASCT1-KO) были получены из Института Сэнгера на генетическом фоне C57BL / 6N.Мыши Slc1a5 KO (ASCT2-KO) были получены от Taconic и скрещены на нашем предприятии с мышами C57BL / 6J в течение 10 поколений. Все процедуры на животных соответствовали требованиям Комитета по надзору за экспериментами на животных (Технион - Израильский технологический институт).

    Вестерн-блоты.

    Мозг гомогенизировали в буфере, содержащем 20 мМ трис-HCl (pH 7,4), 100 мМ NaCl, 0,4 мМ PMSF и 1 мМ EDTA. Гомогенат центрифугировали при 1500 × g в течение 10 минут, супернатант собирали и затем центрифугировали при 200000 × g в течение 30 минут.Осадок, содержащий мембранную фракцию, подвергали SDS / PAGE с последующим вестерн-блоттингом. Для вестерн-блоттинга ASCT2 образцы сначала дегликозилировали путем добавления 1000 единиц PNGase F в неденатурирующих условиях в соответствии с инструкциями производителя (New England Biolabs). Чтобы свести к минимуму агрегацию мембранных белков, образцы не кипятили после добавления буфера для образцов, содержащего SDS.

    Поглощение аминокислот в клеточных культурах.

    Первичные культуры астроцитов получали из коры мышей P0 – P2, как описано ранее (11), и использовали через 12–14 дней после посева.Для экспериментов по поглощению культуры инкубировали в 96-луночных планшетах в течение 5-7 минут с 1 мкМ [ 3 H] аминокислот в физиологическом растворе, забуференном Hepes (HBS, в миллимолях: 137 NaCl, 5,4 KCl, 0,18 Na 2 ). HPO 4 , 0,44 KH 2 PO 4 , 0,41 MgSO 4 , 0,49 MgCl 2 , 1,07 CaCl 2 , 5,6 d-глюкоза, 4,2 NaHCO 3 , 1 пируват Na и 10 Hepes, pH 7,4) при 25 ° C. Транспорт [ 3 H] аминокислот прекращали четырехкратной промывкой клеток ледяной HBS и обработкой, как описано ранее (11).

    Дополнительные методы описаны в Приложении SI , Дополнительные методы .

    Благодарности

    Мы благодарим О. Шварца и доктора Э. Сасс-Тоби (Центр биовизуализации BCF, медицинский факультет Техниона) за МРТ; Доктору Итамару Хану за руководство и контроль при проведении МРТ-анализа; и доктора. Лиат Линде, доктор Ронит Модаи-Ход, Элизабета Гинзбург и Дорон Фогель (Центр геномики BCF, медицинский факультет, Технион) для секвенирования РНК. Работа финансировалась Израильским научным фондом (H.W.) и фонд Вивиан и Оскара Ласко для исследований болезни Паркинсона и Альцгеймера (HW), Центр нейродегенеративных заболеваний головного мозга им. Аллена и Джуэлла Принса (HW, DD и AA), а также фонды партнерства Мичиган-Израиль в области исследований и образования. (HW и RTK). Ж.-М. Б. была поддержана Национальным институтом Санте и де ла Recherche Scientifique. Исследование T.Y. было поддержано Японским агентством медицинских исследований и разработок (AMED) в рамках гранта JP18dm0107083, AMED-Core Research for Evolutional Science and Technology в рамках гранта JP18gm0

    4 и Министерством образования, культуры, спорта, науки и технологий в рамках гранта JP18H05435.

    Сноски

    • Вклад авторов: H.W. задумал проект; D.D., J.-M.B., A.A. и H.W. спланированное исследование; E.K., S.Z., I.R., A.C.V., O.R., H.S., C.S., K.K., K.E., M.W., J.-M.B., A.A. и H.W. проведенное исследование; O.B., K.E., T.Y. и R.T.K. внесены новые реагенты / аналитические инструменты; E.K., S.Z., I.R., A.C.V., O.R., H.S., C.S., D.D., T.Y., M.W., R.T.K., J.-M.B., A.A. и H.W. проанализированные данные; и Х. написал газету.

    • Авторы заявляют об отсутствии конфликта интересов.

    • Эта статья представляет собой прямое представление PNAS.

    • Размещение данных: данные, представленные в этой статье, были депонированы в базе данных Gene Expression Omnibus (GEO), https://www.ncbi.nlm.nih.gov/geo (номер доступа GSE108675).

    • Эта статья содержит вспомогательную информацию на сайте www.pnas.org/lookup/suppl/doi:10.1073/pnas.1722677115/-/DCSupplemental.

    Транспортер бикарбоната необходим для летальности Bacillus anthracis

    Abstract

    В патогенной бактерии Bacillus anthracis вирулентность требует индуцированной экспрессии токсина сибирской язвы и генов капсул.Повышенные уровни CO 2 / бикарбоната, индикатор среды хозяина, обеспечивают сигнал ex vivo для увеличения экспрессии факторов вирулентности, но механизм, лежащий в основе индукции, и его значение in vivo неизвестны. Мы идентифицировали ранее не охарактеризованный переносчик ABC (BAS2714-12), аналогичный переносчикам бикарбоната в фотосинтетических цианобактериях, который необходим для индукции бикарбонатом экспрессии гена вирулентности. Делеция генов переносчика устраняет индукцию экспрессии генов токсина и сильно снижает скорость поглощения бикарбоната ex vivo, демонстрируя, что локус BAS2714-12 кодирует переносчик бикарбоната ABC.Штамм с делецией переносчика бикарбоната был авирулентным в модели инфекции на мышах A / J. Ингибиторы карбоангидразы, которые предотвращают взаимное превращение CO 2 и бикарбоната, значительно влияют на экспрессию токсина только в отсутствие бикарбоната или переносчика бикарбоната, что позволяет предположить, что активность карбоангидразы не важна для индукции фактора вирулентности и этого бикарбоната, а не CO 2 , это сигнал, необходимый для индукции вирулентности. Идентификация этого нового переносчика бикарбоната, необходимого для вирулентности B.anthracis может иметь отношение к другим патогенам, таким как Streptococcus pyogenes , Escherichia coli , Borrelia burgdorferi и Vibrio cholera , которые регулируют экспрессию фактора вирулентности в ответ на CO1118 / burgdorferi 2 может быть целью антибактериального вмешательства.

    Сведения об авторе

    Бактериальные инфекции, приобретенные в больницах, вызывают все большую озабоченность в области общественного здравоохранения. Бактерии, вызывающие эти инфекции, часто устойчивы к нескольким антибиотикам, что делает проблему внутрибольничных инфекций еще более серьезной и необходимость нового антибактериального лечения более острой.Бактерии используют множество механизмов, чтобы вызвать инфекцию, но первым шагом должно быть распознавание среды хозяина. В этой работе мы определили первый компонент пути, который позволяет бактериальному патогену, Bacillus anthracis , распознавать среду, в которой развивается инфекция, то есть кровь хозяина. Обнаруженная молекула - это бикарбонат, критически важный компонент крови для поддержания правильного pH. Бикарбонат необходим для индукции факторов вирулентности B.anthracis и, скорее всего, имеет отношение к инфекциям другими организмами, такими как Streptococci , E. coli , Borrelia , Clostridium botulinum и Vibrio cholera . Наша идентификация переносчика B. anthracis , ответственного за интернализацию бикарбоната и активацию производства фактора вирулентности, представляет собой новую мишень для нового антибактериального вмешательства, которое может быть эффективным в отношении различных бактериальных патогенов.

    Образец цитирования: Wilson AC, Soyer M, Hoch JA, Perego M (2008) Транспортер бикарбоната необходим для Bacillus anthracis Летальность. PLoS Pathog 4 (11): e1000210. https://doi.org/10.1371/journal.ppat.1000210

    Редактор: Майкл С. Гилмор, Исследовательский институт глаза Шепенса, Соединенные Штаты Америки

    Поступила: 27 августа 2008 г .; Одобрена: 20 октября 2008 г .; Опубликовано: 21 ноября 2008 г.

    Авторские права: © 2008 Wilson et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Финансирование: Это исследование было частично поддержано грантом AI055860 Национального института аллергии и инфекционных заболеваний и грантами GM019416 и GM055594 Национального института общих медицинских наук Национальных институтов здравоохранения.Синтез олигонуклеотидов и секвенирование ДНК были частично поддержаны Stein Beneficial Trust.

    Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

    Введение

    Bacillus anthracis - это грамположительная эндоспорообразующая бактерия, являющаяся этиологическим возбудителем сибирской язвы. Сибирская язва - это, в первую очередь, болезнь травоядных животных, зараженных пастбищами, с инфицированием человека в результате прямого контакта с инфицированными продуктами животного происхождения или преднамеренного распространения спор сибирской язвы в качестве биологического оружия.Сибирская язва может проявляться как локализованные кожные инфекции или как системные инфекции, возникающие в результате вдыхания спор, проглатывания или распространения кожных инфекций. Хотя локализованные кожные инфекции излечимы, системные инфекции почти всегда приводят к летальному исходу, причем смерть наступает в течение нескольких дней после первоначального заражения [1].

    Вирулентность в организме-хозяине-млекопитающем требует экспрессии как токсина сибирской язвы, так и антифагоцитарной капсулы. Трехкомпонентный токсин сибирской язвы кодируется тремя несмежными генами, lef , cya и pagA , переносимых плазмидой вирулентности pXO1 [2]. lef кодирует летальный фактор (LF), цинковую металлопротеазу, нацеленную на передачу сигналов MAP-киназы хозяина [3], cya кодирует фактор отека (EF), аденилатциклазу, которая увеличивает клеточные уровни цАМФ [4], а pagA кодирует Защитный антиген (PA), который образует поры, позволяющие проникать компонентам токсина [5]. Антифагоцитарная капсула поли-D-глутаминовой кислоты, которая необходима для распространения бактерий в организме хозяина [6], кодируется генами в опероне cap , переносимом плазмидой вирулентности pXO2 [7], [8].Регуляторный белок AtxA, кодируемый геном atxA на pXO1, необходим для транскрипции как генов токсина, так и капсульного оперона [9], [10]. Контроль AtxA, в свою очередь, интегрирован в несколько метаболических регуляторных цепей, включая фосфорилирование споруляции через AbrB [11] и фосфоенолпируват-зависимую фосфотрансферазную систему через регулируемое фосфорилирование / дефосфорилирование остатков гистидина [12].

    Многие сигналы окружающей среды влияют на экспрессию B.anthracis факторов вирулентности, одним из первых идентифицированных является влияние уровней CO 2 / бикарбоната на образование капсул и вирулентность [13]. Считается, что повышенные уровни CO 2 / бикарбоната служат сигналом среды хозяина млекопитающего и сигналом для индукции экспрессии факторов вирулентности. Инкубация B. anthracis в среде с добавлением бикарбоната натрия, выращенной при повышенных уровнях CO 2 (более 5%), приводит примерно к 10-кратному увеличению транскрипции всех трех генов токсинов [14] и более чем в 20 раз. -кратное увеличение транскрипции капсульного оперона [15].AtxA необходим для индукции CO 2 / бикарбоната токсиновых и капсульных генов, однако на экспрессию AtxA не влияет повышенный уровень CO 2 / бикарбоната [16], [17]. Присутствие дополнительных регуляторных компонентов CO 2 / бикарбонат на основной хромосоме предполагает наблюдение, что транскрипция pagA индуцируется CO 2 / бикарбонатом в штамме pXO1 - pXO2 - при atxA и только pagA поставляются на мультикопийных плазмидах [18].Кроме того, не охарактеризованный ген, переносимый pXO1, также может играть роль в регуляции экспрессии токсина CO 2 / бикарбонат [19]. Несмотря на эти косвенные предположения о более широком регулировании, дополнительные регуляторные компоненты CO 2 / бикарбонат еще не определены напрямую.

    Без механистической основы для регуляции экспрессии фактора вирулентности CO 2 / бикарбонат, наше внимание было обращено на выявление консервативных ответов на гомеостаз CO 2 / бикарбонат и соотнесение этих путей с B.Антиквариат . Изучение метаболизма CO 2 / бикарбоната осложняется его лабильным характером: CO 2 , H 2 CO 3 , HCO 3 - и CO 3 2-, существующих в равновесие в зависимости от pH, температуры и парциального давления CO 2 . В типичных биологических условиях CO 2 обычно диффундирует через мембраны; попав внутрь клетки, углеангидразы могут активно преобразовывать CO 2 и бикарбонат.С другой стороны, бикарбонат непроницаем для липидных бислоев, и многие клеточные системы полагаются на специальные транспортеры для импорта бикарбоната [20]. Одним из наиболее изученных бактериальных транспортеров бикарбоната является транспортная система CmpABCD ABC у цианобактерий вида Synechococcus PCC 7942 (Рисунок 1) [21]. У этой бактерии повышенная концентрация CO 2 вокруг рибулозо-1,5-бисфосфаткарбоксилазы / оксигеназы (Rubisco) важна для эффективной фиксации углерода. Synechococcus использует этот высокоаффинный переносчик бикарбоната для импорта и накопления неорганического углерода (такого как HCO 3 -), который затем может быть преобразован карбоангидразой в CO 2 в присутствии Rubisco в специализированном отделении, называемом карбоксисома [22].

    Рис. 1. Схематическое изображение переносчиков бикарбоната типа ABC в Synechococcus .

    Субстрат-связывающий белок CmpA предположительно закреплен на периплазматической стороне цитоплазматической мембраны через липидный якорь, прикрепленный к консервативному цистину на конце сигнального пептида липопротеина [45].Домен SBP состоит из двух доменов, организованных в форме C-зажима [23]. В Synechococcus домен SBP также присутствует внутриклеточно на карбокси-конце субъединицы CmpC АТФазы. Белок CmpC отсутствует у B. anthracis и S. pyogenes . Кроме того, в S. pyogenes домен SBP слит на своем С-конце с CmpB-подобным доменом пермеазы.

    https://doi.org/10.1371/journal.ppat.1000210.g001

    Здесь мы сообщаем об идентификации переносчика ABC, сходного с системой Synechococcus CmpABCD, которая необходима для вирулентности в B.Антиквариат . Делеция генов переносчика снижает захват бикарбоната и устраняет индукцию гена токсина ex vivo в ответ на бикарбонат. Что еще более важно, штамм, лишенный переносчика, был авирулентным в модели инфекции сибирской язвы на мышах, демонстрируя важность этого пути для распознавания среды хозяина и патогенеза.

    Результаты

    Идентификация предполагаемого транспортера бикарбоната ABC

    Несмотря на признанную роль CO 2 / бикарбоната в синтезе токсина, механизм, связывающий уровни CO 2 / бикарбоната с регуляцией токсина и вирулентностью B.anthracis еще предстоит охарактеризовать. В качестве обратного генетического подхода для идентификации компонентов пути регуляции CO 2 / бикарбонат мы провели поиск в геноме штамма B. anthracis Sterne (GenBank: AE017225) на предмет белковых последовательностей, аналогичных продуктам оперона cmpABCD , кодирующего переносчик бикарбоната Synechococcus elongatus PCC 6301 (GenBank: AP008231). В отличие от многих переносчиков ABC, которые в значительной степени характеризуются на основе мультисубъединичной организации, включая белки с АТФ-связывающими доменами ABC-типа в ассоциации с гидрофобными доменами пермеазы, идентификации CmpABCD-подобных транспортеров бикарбоната ABC помогают структурные особенности домена связывания субстрата для бикарбоната. и очень похожие переносчики нитратов [23], [24].

    Поиск BLASTP выявил сходство между компонентами системы CmpABCD и продуктами генов BAS2714-12 и BAS4675-77 (Таблица 1). Оба оперона еще не были охарактеризованы, но, по-видимому, кодируют компоненты транспортеров ABC. BAS2714 и BAS4676 кодируют АТФ-связывающие белки, BAS2713 и BAS4675, как предполагается, кодируют субстрат-связывающие белки, а BAS2712 и BAS4677, вероятно, являются белками трансмембранной пермеазы. В отличие от cmpABCD , который кодирует два АТФ-связывающих белка (CmpC, также содержащий CmpA-подобный субстрат-связывающий белок, и CmpD) (рисунок 1), два B.Локусы anthracis кодируют только один однодоменный АТФ-связывающий белок (BAS2714 или BAS4676). Роль в транспорте бикарбоната предполагалась присутствием в белках BAS2713 и BAS4675 домена TauA (номер доступа NCBI COG0715), консервативного элемента, связанного с периплазматическими компонентами связывания субстрата ABC-транспортеров, специфичных для нитрата, сульфоната или бикарбоната. Кроме того, биоинформатический анализ с распознаванием складок, проведенный сервером FFAS03, показал очень значимый результат (-60.От 5 до -64,8) между BAS2713 или BAS4675 и белком, связывающим бикарбонатный (CmpA) и нитратный (NrtA) субстрат, что свидетельствует о структурной и функциональной гомологии, несмотря на ограниченную консервацию последовательности. На основании сходства с белками CmpABCD и консервативных свойств, общих для переносчиков бикарбоната, системы BAS2714-12 и BAS4675-77 оказались хорошими кандидатами на роль переносчика бикарбоната ABC B. anthracis .

    Удаление BAS2714-12 устраняет индуцированную бикарбонатом экспрессию генов токсина

    Для исследования роли BAS2714-12 и BAS4675-77 в метаболизме и вирулентности бикарбонатов, B.Были созданы производные штаммы anthracis 34F2 (pXO1 + pXO2 -), содержащие безмаркерные делеции трех генов, аннотированных как BAS2714-12 или BAS4675-77. Как описано в экспериментальных процедурах, с использованием плазмиды pAW091 была удалена область от 97 нуклеотидов перед сайтом начала трансляции BAS2714 до 33 нуклеотидов перед кодоном терминации BAS2712. Это полностью удалило кодирующие области BAS2714 и BAS2713, оставив при этом небольшую часть 3'-конца кодирующей последовательности BAS2712 и всю межгенную область между BAS2712 и BAS2711 нетронутыми, чтобы оставить потенциальные регуляторные последовательности, контролирующие экспрессию нижележащего гена, BAS2711. .

    Аналогичным образом, для делеции BAS4675-77 интеграция плазмиды pAW093 привела к делеции области от 70 нуклеотидов ниже сайта начала трансляции BAS4675 до 52 нуклеотидов выше терминального кодона BAS4677. Это полностью исключило кодирующие области BAS4676, оставив при этом небольшую часть 5'-конца кодирующей последовательности BAS4675 и небольшую часть 3'-конца кодирующей последовательности BAS4677 нетронутыми, чтобы оставить потенциальные регуляторные последовательности, контролирующие экспрессию генов выше по течению. и ниже оперона.

    Во всех испытанных условиях делеция BAS2714-12 или BAS4675-77 не оказывала значительного влияния на рост по сравнению с родительским штаммом 34F2 (фиг. 2 и данные не показаны).

    Рисунок 2. Рост клеток и экспрессия гена вирулентности в B. anthracis 34F2 и 34F2ΔBAS2714-12 в различных условиях роста.

    Для анализов β-галактозида клетки, несущие слияние pagA-lacZ или atxA-lacZ на репликативном векторе pTCV- lac , выращивали в среде с добавлением канамицина.Анализы β-галактозидазы проводили на образцах, взятых с часовыми интервалами, как указано. (A) репортерных штаммов pagA-lacZ , выращенных в бульоне LB на воздухе при 37 ° C. (B) репортерных штаммов pagA-lacZ , выращенных в среде R с 0,8% NaHCO 3 при 5% CO 2 при 37 ° C. (C) репортерных штаммов atxA-lacZ , выращенных в среде R с 0,8% NaHCO 3 при 5% CO 2 при 37 ° C. Символы на всех панелях: - □ - рост клеток 34F2; - ○ - рост клеток 34F2ΔBAS2714-12; -▪- экспрессия LacZ 34F2; - • - Выражение LacZ 34F2ΔBAS2714-12.

    https://doi.org/10.1371/journal.ppat.1000210.g002

    Экспрессия pagA , кодирующая субъединицу PA токсина сибирской язвы, отслеживалась в различных условиях роста, имитируя среду хозяина и среду, не являющуюся хозяином, известную для влияют на экспрессию гена вирулентности. Репортер pagA-lacZ в репликативном векторе pTCV- lac [25] трансформировали в родительские штаммы ΔBAS2714-12 и ΔBAS4675-77 и использовали для мониторинга уровней экспрессии pagA посредством активности β-галактозидазы.Чтобы воспроизвести условия, не связанные с хозяином, которые приводят к низкому уровню экспрессии генов токсина, штаммы выращивали в бульоне LB на воздухе в стандартных лабораторных условиях (рис. 2A), в то время как рост в определенной среде R в присутствии 0,8% NaHCO 3 в 5% атмосфере использовался для имитации среды хозяина (рис. 2В). Делеция генов BAS4675-77 не повлияла на экспрессию pagA ни в одном из тестируемых условий роста, что указывает на то, что эта транспортная система не играет роли в транспорте бикарбоната и / или регуляции экспрессии генов токсина и, следовательно, в дальнейшем не анализировалась (данные не показаны. ).

    Делеция генов BAS2714-12 не повлияла на экспрессию pagA , когда клетки выращивали в LB на воздухе, что позволяет предположить, что эта система не вносит вклад в экспрессию токсина в условиях роста без хозяина (рис. 2А). Напротив, когда штаммы выращивали в определенной R-среде в условиях, которые, как известно, индуцируют экспрессию токсина (0,8% NaHCO 3 и 5% CO 2 ), индукция pagA в штамме с делецией BAS2714-12 была отменена. по сравнению с родительским штаммом (рис. 2В).Эти наблюдения предполагают, что BAS2714-12 необходим для индукции экспрессии токсина в условиях роста CO 2 / бикарбонат, которые, как считается, имитируют хозяина-млекопитающего.

    Первичный регуляторный белок экспрессии токсинового гена в B. anthracis , AtxA, необходим для наблюдаемой индукции экспрессии токсина в ответ на CO 2 / бикарбонат [18], [19]. Предыдущие исследования показали, что транскрипция atxA не индуцируется напрямую в ответ на повышенный уровень CO 2 / бикарбонат [16].Чтобы исследовать вклад BAS2714-12 в регуляцию транскрипции atxA , репортер atxA-lacZ , переносимый вектором pTCV- lac , был электропорирован в штаммах 34F2 и 34F2ΔBAS2714-12. В условиях роста, которые индуцировали экспрессию токсина и при которых мы наблюдали существенное различие в экспрессии pagA , экспрессия atxA не изменилась в 34F2ΔBAS2714-12 по сравнению с исходным штаммом (рис. 2С). Таким образом, в соответствии с отсутствием эффекта на atxA за счет роста в присутствии CO 2 / бикарбоната [16], нарушение метаболизма бикарбоната за счет делеции предполагаемого переносчика бикарбоната BAS2714-12 не влияло на транскрипцию atxA . .

    Чтобы гарантировать, что делеция BAS2714-12 ответственна за наблюдаемые фенотипы, штамм с делецией BAS2714-12 был дополнен этими генами, несущими репликативную плазмиду. Локус BAS2714-12, а также область 640 пар оснований выше BAS2714, которая может нести потенциальные промоторные и регуляторные последовательности, клонировали в мультикопийном векторе pHT315 для генерации плазмиды pAW144, и обе плазмиды электропорировали в штамм 34F2ΔBAS2714-12. Экспрессию защитного антигена контролировали вестерн-блоттингом супернатантов культур (фиг. 3).При выращивании в условиях, индуцирующих токсин, образцы супернатанта 34F2 содержали детектируемые количества PA, в то время как образцы супернатанта 34F2ΔBAS2714-12 не содержали детектируемых уровней PA. При переносе пустой плазмиды pHT315 PA оставался не обнаруживаемым в образцах супернатанта мутантного штамма BAS2714-12, в то время как присутствие pAW144 восстанавливало экспрессию PA, демонстрируя, что делеция BAS2714-12 фактически ответственна за устранение индукции токсина.

    Рисунок 3. Вестерн-блоттинг с использованием антитела α-PA.

    Штаммы, выращенные в среде R с 0,8% NaHCO 3 при 5% CO 2 при 37 ° C с добавлением эритромицина и линкомицина по мере необходимости. Количество образца, загруженного на 10% гель SDS-PAGE, нормализовали относительно плотности клеток. Дорожка 1, MagicMark XP; Дорожка 2, штамм 34F2; Дорожка 3, штамм 34F2ΔBAS2714-12; Дорожка 4: штамм 34F2ΔBAS2714-12, несущий плазмиду pHT315; Дорожка 5: штамм 34F2ΔBAS2714-12, несущий плазмиду pAW144.

    https://doi.org/10.1371/journal.ppat.1000210.g003

    Удаление BAS2714-12 снижает поглощение бикарбонатов

    Сходство последовательностей с известными переносчиками бикарбоната и устранение индуцированной бикарбонатом экспрессии токсина после делеции предполагают, что BAS2714-12 может функционировать как переносчик бикарбоната. Чтобы напрямую проверить функцию BAS2714-12 в транспорте бикарбоната, мы сравнили поглощение радиоактивно меченного NaH 14 CO 3 в родительском и мутантном штаммах. Штаммы 34F2 и 34F2ΔBAS2714-12 выращивали в R-среде без добавления NaHCO 3 в присутствии 5% CO 2 до OD 600 , равного 0.4. К каждой культуре добавляли NaH 14 CO 3 и измеряли поглощение NaH 14 CO 3 в нескольких временных точках с помощью жидкостного сцинтилляционного счета (Фиг.4). Поглощение 14 C в штамме 34F2ΔBAS2714-12 происходило со значительно более низкой скоростью (в 6 раз), чем в родительском штамме 34F2, что свидетельствует о нарушении поглощения бикарбоната и дает дополнительные доказательства того, что BAS2714-12 функционирует как переносчик бикарбоната.

    Рис. 4. Поглощение H 14 CO 3 - на B.anthracis 34F2 и 34F2ΔBAS2714-12.

    Клетки выращивали в среде R без добавления NaHCO 3 при 5% CO 2 при 37 ° C до OD 600 = 0,4. NaH 14 CO 3 добавляли в момент времени 0 и образцы клеток собирали в указанные моменты времени. H 14 CO 3 - поглощение определяли по накоплению 14 C в клетках, как измерено с помощью жидкостного сцинтилляционного счета; -▪- родительский штамм 34F2, - • - штамм 34F2ΔBAS2714-12.Данные были получены из 3 независимых культур, и планки погрешностей представляют собой стандартное отклонение от среднего.

    https://doi.org/10.1371/journal.ppat.1000210.g004

    Ингибиторы карбоангидразы незначительно влияют на индукцию экспрессии токсина бикарбонатом

    Транспортеры бикарбоната импортируют непроницаемый для мембраны бикарбонат, в то время как ферменты карбоангидразы взаимно превращают бикарбонат и CO 2 и, таким образом, способны превращать проницаемый через мембрану CO 2 в бикарбонат [20].На индукцию экспрессии токсина в B. anthracis влияют как бикарбонат, так и CO 2 , и, учитывая взаимное превращение этих двух соединений, разделение относительного влияния каждого соединения на вирулентность было затруднено. Идентификация и удаление транспортера бикарбоната, необходимого для индукции токсина, теперь предоставили инструмент для дальнейшего исследования механизма индукции.

    Был протестирован набор доступных ингибиторов карбоангидразы, включая ацетазоламид, этоксизоламид, гидрохлоротиазид и топирамат.Гидрохлоротиазид оказался наиболее эффективным, что было измерено по снижению уровней экспрессии токсина (данные не показаны). В присутствии NaHCO 3 и CO 2 экспрессия pagA-lacZ в родительском штамме 34F2 была идентична с гидрохлоротиазидом или без него (фиг. 5A). Однако остаточная экспрессия pagA-lacZ в штамме 34F2▵BAS2714-12 полностью подавлялась гидрохлоротиазидом. Без добавления NaHCO 3 , но в присутствии 5% CO 2 в атмосфере гидрохлоротиазид снижал экспрессию pagA-lacZ в родительском штамме 34F2, а гидрохлоротиазид дополнительно снижал уровень экспрессии pagA-lacZ в штамме 3414F2ΔBAS27 -12 (рис. 5В).Эти данные предполагают, что остаточная экспрессия pagA-lacZ в отсутствие добавленного NaHCO 3 обусловлена ​​превращением CO 2 в - HCO 3 под действием карбоангидразы. Эти данные также подтверждают идею о том, что именно бикарбонат, а не CO 2 непосредственно сигнализирует об индукции экспрессии фактора вирулентности в условиях роста хозяина.

    Рисунок 5. Экспрессия гена токсина в B. anthracis 34F2 и 34F2ΔBAS2714-12 в присутствии гидрохлоротиазида, ингибитора карбоангидразы.

    Клетки, несущие слияние pagA-lacZ на репликативном векторе pTCV- lac или без промотора pTCV- lac , выращивали в среде с добавлением канамицина. Анализы β-галактозидазы проводили на образцах, взятых с часовыми интервалами, как указано. (A) Штаммы, выращенные в среде R с 0,8% NaHCO 3 под 5% CO 2 при 37 ° C. (B) Штаммы, выращенные в среде R без добавления NaHCO 3 при 5% CO 2 при 37 ° C. Символы на всех панелях: -▪- 34F2 pagA-lacZ выражение; - □ - экспрессия 34F2 pagA-lacZ с 900 мкМ гидрохлоротиазидом; - • - экспрессия 34F2ΔBAS2714-12 pagA-lacZ ; - ○ - экспрессия 34F2ΔBAS2714-12 pagA-lacZ с 900 мкМ гидрохлоротиазидом; -▴- экспрессия pTCV- lac без промотора 34F2; -▵- Без промотора 34F2 экспрессия pTCV- lac с 900 мкМ гидрохлоротиазидом.

    https://doi.org/10.1371/journal.ppat.1000210.g005

    Удаление BAS2714-12 сделало

    вирулентным B. anthracis на мышиной модели инфекции

    Хотя роль CO 2 / бикарбоната в индукции экспрессии гена вирулентности хорошо продемонстрирована в лабораторных пакетных культурах ( ex vivo ), пока не предоставлено никаких доказательств того, что эта роль также актуальна для B. anthracis клетки, растущие в инфицированном хозяине ( in vivo, ).Чтобы исследовать, влияет ли неспособность импортировать бикарбонат на вирулентность B. anthracis , была использована модель инфекции на животных, в которой использовалась линия мышей, очень чувствительная к неинкапсулированным штаммам Sterne [26]. Шестинедельным самкам мышей штамма A / J с дефицитом комплемента (The Jackson Laboratory) подкожно вводили 10 6 спор родительского штамма 34F2 или мутантного штамма 34F2▵BAS2714-12 и наблюдали в течение 12 дней.Группа из пяти мышей A / J была инфицирована каждым штаммом. В течение 54 часов у мыши из контрольной группы 34F2, инфицированной родительским штаммом, наблюдалась значительная опухоль и снижалась физическая активность. Смерть наступила в течение следующих 10 часов. В этой группе у двух других мышей появились симптомы заболевания и они умерли в течение 72 часов, четвертая - через 84 часа, а пятая мышь - через 96 часов после заражения (Фиг.6). Напротив, все 5 мышей в группе, инфицированной мутантом, выжили до 12 дней без явных признаков опухоли или заболевания.В то время как родительский штамм является полностью вирулентным в этой модели мыши, ΔBAS2714-12 является авирулентным, что впервые демонстрирует, что транспорт бикарбоната важен для патогенеза B. anthracis in vivo .

    Фигура 6. 34F2 и 34F2ΔBAS2714-12 в мышиной модели инфекции.

    В общей сложности 10 самкам мышей A / J в возрасте 6 недель, 5 для 34F2 (- • -) и 5 ​​для 34F2ΔBAS2714-12 (-▪-), подкожно инъецировали 10 6 спор и контролировали курс 12 дней.Ежедневно за мышами наблюдали визуально на предмет активности, и данные выражали в виде процента выживаемости.

    https://doi.org/10.1371/journal.ppat.1000210.g006

    Обсуждение

    B. anthracis должен интегрировать многочисленные сигналы окружающей среды, чтобы эффективно воспроизводить и вызывать заболевание. B. anthracis основан на многофазном образе жизни: неметаболически активные споры необходимы для заражения и распространения между хозяевами, но сами по себе неспособны к репликации, в то время как метаболически активные вегетативные клетки реплицируются и вызывают заболевание в хозяине, но неспособны распространяться между хозяевами. .В течение инфекционного цикла пути, ведущие либо к развитию через споруляцию, либо к патогенезу через образование токсинов и капсул, являются взаимоисключающими, предполагая существование регуляторного баланса между двумя путями [27]. То, что бактерия распознает в хозяине как сигналы, вызывающие механизмы патогенеза, и природа механизмов, необходимых для принятия участия в развитии или патогенезе, остаются плохо изученными. Здесь мы определили важный компонент для индукции экспрессии гена вирулентности в ответ на уровни бикарбоната в организме хозяина и использовали это открытие для понимания внеклеточных и внутриклеточных сигналов, контролирующих вирулентность.

    Наши данные продемонстрировали, что гены BAS2714-12 кодируют ранее не охарактеризованный переносчик бикарбоната ABC. Подобные переносчики ABC были идентифицированы и охарактеризованы у фотосинтезирующих бактерий [21], но это первое сообщение о переносчике ABC, участвующем в вирулентности у патогенных видов бактерий. Система BAS2714-12 изначально была аннотирована (Gen Bank: AE017225) как предполагаемый переносчик сульфонатов, во многом из-за сходства с охарактеризованным переносчиком Ssu ABC в B.subtilis . Однако, учитывая консервативность между переносчиками бикарбоната, нитрата и сульфоната ABC, отсутствие охарактеризованных переносчиков бикарбоната у грамположительных бактерий и сложность прогнозирования функции переносчиков ABC на основе нуклеотидной последовательности, определение специфичности субстрата неоднозначно. Здесь мы показали, что транспортер ABC, кодируемый BAS2714-12, необходим для интернализации 14 C-меченного бикарбоната. Вместе с тем, что добавление таурина, субстрата B.subtilis Ssu system [28] и широко доступное сульфонатное соединение в организме хозяина, не влияет на экспрессию токсинового гена и не конкурирует с индукцией бикарбоната (неопубликованные данные), свидетельствует о том, что система BAS2714-12 специфична для транспорта бикарбоната. Дополнительное наблюдение, что делеция генов BAS2714-12 устраняет бикарбонат-зависимую индукцию экспрессии генов токсина, подтверждает роль этой системы транспортеров в метаболизме бикарбонатов у B. anthracis .

    Удаление BAS2714-12 устраняет индукцию бикарбонатом экспрессии pagA в условиях роста, которые имитируют среду животного-хозяина, но существенно не изменяют экспрессию в неиндуцирующих условиях. В среде LB без добавления бикарбоната или CO 2 , условиях, которые имитируют условия, не связанные с хозяином и не индуцирующие токсины, экспрессия pagA не изменяется в штамме с делецией. Напротив, при выращивании в R-среде с добавлением бикарбоната и CO 2 , условиях, которые имитируют условия индукции хозяина и токсина, экспрессия pagA остается очень низкой в ​​мутантном штамме, в то время как экспрессия pagA сильно индуцируется в родительском штамме. .Эти наблюдения предполагают, что на базальные уровни экспрессии pagA не влияет делеция BAS2714-12, но вместо этого для специфической индукции бикарбонатом требуется присутствие BAS2714-12. Несмотря на сильное влияние делеции BAS2714-12 на индукцию токсина, штамм с делецией не показывает различий в росте при любых испытанных условиях по сравнению с родительским штаммом, что позволяет предположить, что поглощение бикарбоната через BAS2714-12 не вносит значительного вклада в невирулентные метаболические пути при лабораторные условия выращивания.Делеция BAS2714-12 может быть дополнена поставкой локуса в транс- репликативной плазмиды. Небольшие различия в экспрессии pagA между родительскими штаммами и штаммами с делецией-комплементацией, вероятно, связаны с различиями в экспрессии или количестве копий гена BAS2714-12, переносимого на плазмиде с относительно высоким числом копий (15 копий на клетку [29]).

    Присутствие регулятора AtxA необходимо для высокого уровня экспрессии pagA в ответ на CO 2 / бикарбонат, но транскрипция atxA напрямую не регулируется CO 2 / бикарбонатом [16].В соответствии с этими наблюдениями делеция BAS2714-12 не повлияла на транскрипцию atxA (рис. 2С).

    Влияние BAS2714-12 на вирулентность в модели in vivo на животных резко: в то время как, как и ожидалось, инфицирование мышей A / J спорами родительского штамма 34F2 быстро привело к обширному отеку с последующей смертью [30], заражение спорами делеционного штамма не показало никаких визуальных признаков инфекции, и все мыши выжили до конца эксперимента (фиг. 6).Эти результаты подтвердили корреляцию между бикарбонат-зависимой индукцией экспрессии гена токсина ex vivo и вирулентностью B. anthracis in vivo . Модель инфекции на мышах A / J была выбрана из-за чувствительности к инфекции продуцирующим токсин штаммом Sterne 34F2 (pXO1 + pXO2 - ). Однако вирулентность в организме человека-хозяина требует экспрессии как токсина, так и капсулы. Экспрессия в капсулах, как и продукция токсинов, индуцируется бикарбонатом [15].Учитывая аналогичную зависимость индуцированной бикарбонатом индукции капсулы как от AtxA, так и от геномных последовательностей [10], [15], вполне вероятно, что делеция BAS2714-12 также устранит индукцию образования капсул и, следовательно, вирулентность полностью вирулентного, штамм, продуцирующий токсины и капсулы.

    Бикарбонат, а не CO 2 , по-видимому, является первичной молекулой, регулирующей индукцию экспрессии гена вирулентности. Если бы CO 2 был первичной сигнальной молекулой, можно было бы ожидать снижения экспрессии токсина в присутствии ингибитора карбоангидразы, поскольку бикарбонат в растворе больше не может быстро превращаться в CO 2 внутри клетки.Вместо этого мы наблюдали противоположный феномен: ингибирование активности карбоангидразы влияет только на экспрессию токсина в отсутствие добавленного бикарбоната или когда бикарбонат больше не может быть импортирован в клетку (Рисунок 5), условия, при которых карбоангидраза будет преобразовывать CO 2 в бикарбонат. Индукция экспрессии токсина ex vivo за счет высоких уровней CO 2 в атмосфере в отсутствие добавленного бикарбоната, вероятно, является результатом спонтанного или управляемого карбоангидразами преобразования CO 2 в бикарбонат, что затем сигнализирует об увеличении экспрессии токсина.Сенсорный или метаболический путь, который напрямую реагирует на бикарбонат и индуцирует экспрессию токсинового гена, остается неизвестным, но его идентификация является постоянным центром нашей работы.

    Бикарбонат - основной элемент в организме млекопитающих. Он присутствует во всех жидкостях и органах организма и играет важную роль в кислотно-основном гомеостазе. Нормальная концентрация бикарбоната в крови колеблется между 22–26 мМ и его присутствие вместе с угольной кислотой (H 2 CO 3 ), ионами водорода и диоксидом углерода образует буферную систему, необходимую для обеспечения устойчивости к резким изменениям в крови. Значения pH.Бикарбонат, выделяемый поджелудочной железой, также регулирует pH в тонком кишечнике, нейтрализуя кислоту, поступающую в двенадцатиперстную кишку из желудка [31], [32]. Таким образом, бикарбонат может быть сигнальной молекулой вирулентности для патогенеза энтеробактерий, а также патогенами, передающимися с кровью.

    B. anthracis не единственный среди бактерий, регулирующий экспрессию гена вирулентности в ответ на CO 2 / бикарбонат. CO 2 и / или бикарбонат увеличивает выработку токсинов в Vibrio cholerae [33] и Staphylococcus aureus [34], индуцирует экспрессию генов прикрепления в Escherichia coli O157: H7 [35], изменяет антигенный профиль Borrelia burgdorferi [36], и активирует регуляторный белок вирулентности в Citrobacter rodentium [37].В любой из этих систем система транспорта бикарбоната, подобная BAS2714-12, может непосредственно участвовать в транспорте бикарбоната и стимуляции экспрессии фактора вирулентности. Наиболее непосредственное отношение к бикарбонатной регуляции в B. anthracis - это стимуляция антифагоцитотического белка М в Streptococcus pyogenes [38]. Экспрессия М-белка контролируется регуляторным белком Mga, фактором транскрипции, который похож на регуляторный белок B. anthracis AtxA, поскольку он содержит два домена PRD и может регулироваться посредством фосфорилирования / дефосфорилирования через систему утилизации углеводов PTS. [12], [39].Очевидное перекрытие метаболических систем CO 2 / бикарбонат и регуляция доменов PRD в регуляторных белках в ответ на утилизацию углеводов наводит на мысль о сходных системах транспорта и регуляции бикарбоната между этими патогенными видами. Интересно, что поиск BLAST штамма S. pyogenes M6 (номер доступа NC_006086) с использованием субстрат-связывающего белка BAS2713 в качестве запроса выявил продукт гена Spy1045 как белок с наибольшим сходством (21%) и домен TauA. в его аминоконцевой половине белка.В С-концевой части Spy1045 содержит пермеазный домен ABC-типа (суперсемейство компонентов внутренней мембраны связывающей белковой системы cl00427), который вместе с АТФазным доменом, кодируемым геном Spy1046 (35% идентичности с BAS2714), может составлять переносчик бикарбоната S. pyogenes (рис. 1).

    Регулирование фактора вирулентности B. anthracis требует сложного взаимодействия между перекрывающимися метаболическими системами, но впервые мы раскрыли специальные транспортные компоненты пути регуляции CO 2 / бикарбонат.Это позволило нам напрямую разделить влияние нескольких сигнальных молекул, чтобы обнаружить, что бикарбонат непосредственно ответственен за индукцию in vivo , а также ex vivo , экспрессию фактора вирулентности, которая важна для патогенеза B. anthracis . Примечательно, что доступность трехмерной структуры бикарбонатсвязывающего домена белка CmpA Synechococcus в присутствии и в отсутствие лиганда может быть использована для выявления специфических ингибиторов этого домена и предоставления новых возможностей для антибактериального вмешательства [23].В свете этих результатов исследование регуляции и транспорта бикарбонатов должно иметь гораздо большее значение для большого числа патогенных организмов.

    Материалы и методы

    Штаммы бактерий и условия роста

    B. anthracis Sterne 34F2 (pXO1 + pXO2 - ) и его производные обычно выращивали в бульоне LB с добавлением соответствующих антибиотиков в следующих концентрациях: хлорамфеникол 7.5 мкг / мл, тетрациклин 5 мкг / мл, эритромицин 5 мкг / мл, линкомицин 25 мкг / мл или канамицин 7,5 мкг / мл. 5-бром-4-хлор-3-индолил-β-D-галактопиранозид (X-Gal) добавляли в конечной концентрации 40 мкг / мл в агар LB для мониторинга активности β-галактозидазы в твердой среде. Все ингибиторы карбоангидразы (Sigma) были свежеприготовлены в ДМСО непосредственно перед добавлением в культуры. Чтобы вызвать экспрессию токсина на высоком уровне, B. anthracis выращивали в чашках с LB-агаром или жидких средах LB, содержащих 0.8% бикарбонат натрия и 100 мМ 4- (2-гидроксиэтил) -1-пиперазинэтансульфоновая кислота (HEPES) [pH 8,0] или в R-Media [40] при 5% CO 2 . Электрокомпетентные клетки B. anthracis получали по методу Koehler et al [18].

    Штамм E. coli TG1 использовали для конструирования и размножения плазмиды. Штамм E. coli SCS110 был использован для получения неметилированной ДНК для трансформации в B. anthracis . Трансформация E. coli была проведена электропорацией с использованием импульсного генератора Bio-Rad Gene Pulser согласно заявлению поставщика. Трансформанты отбирали на бульоне LB с добавлением ампициллина (100 мкг / мл), хлорамфеникола (7,5 мкг / мл) или канамицина (30 мкг / мл).

    Делеция безмаркерного гена

    Делеции гена в B. anthracis были созданы по существу методом Джейнса и Стибица [41]. Область длиной 738 п.н. перед BAS2714 амплифицировали с использованием праймеров BAS2714U5'Bam и BAS2714U3'Sal (таблица S1), тогда как область 828 п.н. ниже BAS2712 амплифицировали с использованием праймеров BAS2712D5'Sal и BAS2712D3'Pst.Затем секвенированные продукты клонировали в термочувствительную плазмиду pORI-I-SceI [42] для получения плазмиды pAW091. Для делеции BAS4675-77 область длиной 624 п.о. перед BAS4675 амплифицировали с использованием праймеров BAS4675U5'Bam и BAS4675U3'Sal, а область 750 п.о. ниже BAS4677 амплифицировали с использованием праймеров BAS4677D5'Sal и BAS4677D5'Pst. Секвенированные продукты также клонировали в плазмиде pORI-I-SceI для получения плазмиды pAW093. Плазмиды pAW091 и pAW093 электропорировали в B.anthracis 34F2 и выращивали при разрешающей температуре 28 ° C в присутствии левомицетина. Затем бактерии переводили на недопустимую температуру 37 ° C в присутствии хлорамфеникола для достижения целевой интеграции плазмиды путем гомологичной рекомбинации. После интеграции плазмиды следовали протоколу Janes и Stibitz [41] для создания безмаркерной делеции. Диагностическая ПЦР была проведена, чтобы убедиться, что вся кодирующая последовательность была правильно удалена. Диагностическая ПЦР также проводилась на геномной ДНК с использованием atxA -специфических праймеров, чтобы гарантировать, что плазмида pXO1 не была потеряна во время процесса (таблица S1).

    Анализ комплементации

    Область BAS2714-12, включающая область 640 пар оснований выше BAS2714, содержащую потенциальные регуляторные последовательности, амплифицировали с использованием праймеров BAS27145'Xba и BAS27123'Hind и вводили в вектор pCR4Blunt-TOPO (Invitrogen). После секвенирования вставку удалили расщеплением XbaI-HindIII и лигировали в многокопийный плазмидный вектор pHT315, расщепленный XbaI-HindIII [29], с получением плазмиды pAW144. pAW144, а также векторную плазмиду pHT315, электропорировали в родительские штаммы 34F2 и 34F2ΔBAS2714-12.Диагностическая ПЦР проводилась на геномной ДНК с использованием праймеров, специфичных для atxA , чтобы гарантировать, что плазмида pXO1 не была потеряна во время процесса.

    Анализ β-галактозидазы

    B. anthracis штаммов, несущих слияния pagA-lacZ [12] или atxA-lacZ (pAtxA12 [17]) на репликативном векторе слияния транскрипции pTCV-lac [25], выращивали при 37 ° C в LB или среда R с добавлением соответствующих антибиотиков. Активность β-галактозидазы определяли, как описано ранее, и удельную активность выражали в единицах Миллера [43], [44].

    SDS-PAGE и вестерн-блоттинг

    Штаммы B. anthracis выращивали в среде R до приблизительно OD 600 1,0 в течение 8 часов в атмосфере 5% CO 2 при 37 ° C, и образцы супернатанта выделяли микроцентрифугированием клеточных суспензий. Буфер для образцов SDS добавляли к каждому супернатанту, и образцы кипятили в течение 5 минут и загружали в гели 10% SDS-PAGE. Загруженное количество нормализовали относительно плотности клеток. Гели работали при 30 мА в течение приблизительно 2 часов.Гели переносили на PVDF-мембрану (BioRad) в буфере для переноса (25 мМ трис-основания, 192 мМ глицин, 20% метанол) при 20 В в течение ночи. Мембраны инкубировали в течение 30 минут при комнатной температуре в блокирующем буфере (5% сухое молоко в TBST (20 мМ Tris-HCl pH 7,5, 150 мМ NaCl, 0,1% Tween 20)) с последующим добавлением поликлональных антител защитного антигена, разведенных 1 10 000 фунтов стерлингов. Блоты промывали 5 раз и затем инкубировали в течение 1 часа при комнатной температуре с козьими антикроличьими антителами, конъюгированными с пероксидазой хрена (BioRad), разведенными 1-10 000 в блокирующем буфере.После промывания мембраны связывание антител исследовали с помощью набора ECL Plus (GE), и полосы белка визуализировали с помощью PhosphorImager (Molecular Dynamics).

    Анализ поглощения бикарбонатов

    Ночные культуры штаммов B. anthracis 34F2 и 34F2ΔBAS2714-12 разводили 1 × 100 в среде R без добавления NaHCO 3 и выращивали в 60 мл стерильных флаконах для культивирования при 37 ° C в атмосфере 5% CO 2 . Когда культуры достигли ОП 600 0.4, 50 мкКи NaH 14 CO 3 (MP Biomedical) добавляли к каждой культуре. Через указанные интервалы времени клетки отделяли от 1 мл культуры вакуумной фильтрацией на стеклянных фильтрах (Millipore) и немедленно промывали 10 мл холодной среды. Затем фильтры помещали в стеклянные флаконы, содержащие 5 мл счетной смеси Bio-Safe II (RPI corp.), И радиоактивность, удерживаемую на фильтре, измеряли в жидкостном сцинтилляционном анализаторе Packard 1600 TR.

    Препарат для спор

    Б.anthracis Штаммы 34F2 и 34F2ΔBAS2714-12 выращивали в среде для споруляции Шеффера в течение приблизительно 72 часов, пока более 80% спор не стали единичными и свободными по данным фазово-контрастной микроскопии. Клетки собирали центрифугированием при 10000 g в течение 30 минут, среду отсасывали и осадок клеток ресуспендировали в 20 мл стерильной дистиллированной воды. Клетки промывали дважды в день в течение 5 дней центрифугированием при 12000 g и ресуспендированием в 20 мл свежей стерильной воды для удаления большей части вегетативных клеток.Затем осадки клеток ресуспендировали в 20% ренографине (Squibb) и осторожно наслаивали поверх 50% ренографина в центрифужной пробирке Corex на 30 мл. Затем пробирки центрифугировали при 13000 g в течение 30 минут. Супернатант, содержащий вегетативные формы, удаляли и очищенные осадки спор ресуспендировали в 1 мл стерильной воды. Осадки спор промывали дважды в день в течение 3 дней микроцентрифугированием при 14000 об / мин с последующим ресуспендированием осадка спор в 1 мл стерильной воды. Общее количество спор измеряли с помощью гемацитометра, в то время как количество живых спор измеряли серийным разведением с последующим посевом на LB-агар.

    Инфекция мыши

    самкам мышей A / J в возрасте 6 недель (The Jackson Laboratory) подкожно инъецировали 10 6 спор, очищенных ренографином. Прогрессирование заболевания контролировали визуально в течение 12 дней. Всех мышей содержали и содержали в помещении для животных Научно-исследовательского института Скриппса с одобрения Институционального комитета по уходу за животными и их использованию.

    Благодарности

    Это рукопись номер 19701 из Исследовательского института Скриппса.

    Вклад авторов

    Задумал и спроектировал эксперименты: ACW JAH MP. Проведены эксперименты: ACW MS. Проанализированы данные: ACW JAH MP. Написал статью: ACW JAH MP.

    Ссылки

    1. 1. Диксон Т.К., Мезельсон М., Гийемин Дж., Ханна П.С. (1999) Anthrax. N Engl J Med 341: 815–826.
    2. 2. Okinaka RT, Cloud K, Hampton O, Hoffmaster AR, Hill KK и др. (1999) Последовательность и организация pXO1, большой плазмиды Bacillus anthracis , несущей гены токсина сибирской язвы.J Bacteriol 181: 6509–6515.
    3. 3. Дюсбери Н.С., Уэбб С.П., Леппла С.Х., Гордон В.М., Климпель К.Р. и др. (1998) Протеолитическая инактивация МАР-киназы-киназы летальным фактором сибирской язвы. Наука 280: 734–737.
    4. 4. Leppla SH (1982) Фактор отека токсина сибирской язвы: бактериальная аденилатциклаза, которая увеличивает концентрацию циклического АМФ в эукариотических клетках. Proc Natl Acad Sci U S A 79: 3162–3166.
    5. 5. Milne JC, Furlong D, Hanna PC, Wall JS, Collier RJ (1994) Защитный антиген сибирской язвы образует олигомеры во время интоксикации клеток млекопитающих.J Biol Chem 269: 20607-20612.
    6. 6. Дрисдейл М., Хенингер С., Хатт Дж., Чен И., Лайонс С.Р. и др. (2005) Синтез капсулы Bacillus anthracis необходим для распространения ингаляционной сибирской язвы у мышей. EMBO J 24: 221–227.
    7. 7. Makino S, Uchida I, Terakado N, Sasakawa C, Yoshikawa M (1989) Молекулярная характеристика и анализ белка области кэпа, которая необходима для инкапсуляции в Bacillus anthracis . J Bacteriol 171: 722–730.
    8. 8. Candela T, Mock M, Fouet A (2005) CapE, пептид из 47 аминокислот, необходим для синтеза полиглутаматной капсулы Bacillus anthracis . J Bacteriol 187: 7765–7772.
    9. 9. Dai Z, Sirard JC, Mock M, Koehler TM (1995) Продукт гена atxA активирует транскрипцию генов токсина сибирской язвы и необходим для вирулентности. Mol Microbiol 16: 1171–1181.
    10. 10. Uchida I, Makino S, Sekizaki T, Terakado N (1997) Перекрестный разговор с генами синтеза капсулы Bacillus anthracis с помощью atxA , гена, кодирующего trans -активатор синтеза токсина сибирской язвы.Мол микробиол 23: 1229–1240.
    11. 11. Saile E, Koehler TM (2002) Контроль экспрессии гена токсина сибирской язвы с помощью регулятора переходного состояния abrB . J Bacteriol 184: 370–380.
    12. 12. Цветанова Б., Уилсон А.С., Бонджорни С., Чианг С., Хох Дж. А. и др. (2007) Противоположные эффекты фосфорилирования гистидина регулируют фактор транскрипции вирулентности AtxA в Bacillus anthracis . Mol Microbiol 63: 644–655.
    13. 13. Sterne M (1937) Вариация Bacillus anthracis .Onderstepoort J Vet Sci Anim Ind 8: 271–349.
    14. 14. Sirard JC, Mock M, Fouet A (1994) Три гена токсина Bacillus anthracis координированно регулируются бикарбонатом и температурой. J Bacteriol 176: 5188–5192.
    15. 15. Fouet A, Mock M (1996) Дифференциальное влияние двух плазмид Bacillus anthracis на регуляцию экспрессии гена вирулентности. Infect Immun 64: 4928–4932.
    16. 16. Dai Z, Koehler TM (1997) Регулирование экспрессии гена активатора токсина сибирской язвы ( atxA ) в Bacillus anthracis : температура, а не CO2 / бикарбонат, влияет на синтез AtxA.Инфекция иммунной 65: 2576–2582.
    17. 17. Бонджорни С., Фукусима Т., Уилсон А.С., Чанг К., Мансилла М.С. и др. (2008) Двойные промоторы контролируют экспрессию фактора вирулентности Bacillus anthracis AtxA. J Bacteriol 190: 6483–6492.
    18. 18. Koehler TM, Dai Z, Kaufman-Yarbray M (1994) Регулирование гена защитного антигена Bacillus anthracis : CO2 и транс-действующий элемент активируют транскрипцию с одного из двух промоторов. J Bacteriol 176: 586–595.
    19. 19. Uchida I, Hornung JM, Thorne CB, Klimpel KR, Leppla SH (1993) Клонирование и характеристика гена, продукт которого является трансактиватором синтеза токсина сибирской язвы. J Bacteriol 175: 5329–5338.
    20. 20. Кейси-младший (2006) Почему бикарбонат? Biochem Cell Biol 84: 930–939.
    21. 21. Омата Т., Прайс Г.Д., Барсук М.Р., Окамура М., Гохта С. и др. (1999) Идентификация АТФ-связывающего кассетного транспортера, участвующего в захвате бикарбоната цианобактериями Synechococcus sp., штамм PCC 7942. Proc Natl Acad Sci U S. A 96: 13571–13576.
    22. 22. Барсук М.Р., Прайс Г.Д. (2003) Механизмы концентрации СО2 в цианобактериях: молекулярные компоненты, их разнообразие и эволюция. J Exp Bot 54: 609–622.
    23. 23. Коропаткин Н.М., Коппенаал Д.В., Пакраси Х.Б., Смит Т.Дж. (2007) Структура цианобактериального транспортного белка бикарбоната, CmpA. J Biol Chem 282: 2606–2614.
    24. 24. Коропаткин Н.М., Пакраси Х.Б., Смит Т.Дж. (2006) Атомная структура нитрат-связывающего белка, имеющая решающее значение для продуктивности фотосинтеза.Proc Natl Acad Sci U S A 103: 9820–9825.
    25. 25. Poyart C, Trieu-Cuot P (1997) Мобильный челночный вектор с широким кругом хозяев для конструирования транскрипционных слияний с β-галактозидазой в грамположительных бактериях. FEMS Microbiol Lett 156: 193–198.
    26. 26. Welkos SL, Keener TJ, Gibbs PH (1986) Различия в восприимчивости инбредных мышей к Bacillus anthracis. Заражение иммунной 51: 795–800.
    27. 27. Perego M, Hoch JA (2008) Объединение регуляторных систем после приобретения плазмид вирулентности Bacillus anthracis .Trends Microbiol 16: 215–221.
    28. 28. van der Ploeg JR, Barone M, Leisinger T (2001) Экспрессия генов утилизации сульфонат-сера Bacillus subtilis регулируется на уровнях инициации и терминации транскрипции. Мол микробиол 39: 1356–1365.
    29. 29. Arantes O, Lereclus D (1991) Конструирование векторов клонирования для Bacillus thuringiensis . Ген 108: 115–119.
    30. 30. Duong S, Chiaraviglio L, Kirby JE (2006) Гистопатология в мышиной модели сибирской язвы.Инт. Ж. Эксп. Патол 87: 131–137.
    31. 31. Ван Слайк Д.Д. (1922) Исследования ацидоза. XVIII. Определение концентрации бикарбонатов в крови и плазме. J Biol Chem 52: 495–499.
    32. 32. Barrett DH (2003) Кислотно-щелочной баланс и интерпретация результатов анализа газов крови. Обновления в Анестезии 16: Статья 2.
    33. 33. Иванага М., Ямамото К. (1985) Новая среда для продукции холерного токсина Vibrio cholerae O1 биотипа Эль Тор.J Clin Microbiol 22: 405-408.
    34. 34. Росс Р.А., Ондердонк А.Б. (2000) Производство токсина 1 синдрома токсического шока с помощью Staphylococcus aureus требует как кислорода, так и углекислого газа. Infect Immun 68: 5205–5209.
    35. 35. Abe H, Tatsuno I, Tobe T, Okutani A, Sasakawa C (2002) Ион бикарбоната стимулирует экспрессию локуса генов, кодируемых сглаживанием энтероцитов, в энтерогеморрагической Escherichia coli O157: H7. Заражение иммунной 70: 3500–3509.
    36. 36. Hyde JA, Trzeciakowski JP, Skare JT (2007) Borrelia burgdorferi изменяет экспрессию своих генов и антигенный профиль в ответ на уровни CO2. J Bacteriol 189: 437–445.
    37. 37. Ян Дж., Харт Э., Таушек М., Прайс Г. Д., Хартланд Э. Л. и др. (2008) Опосредованная бикарбонатом активация транскрипции дивергентных оперонов регуляторным белком вирулентности RegA из Citrobacter rodentium . Mol Microbiol 68: 314–327.
    38. 38.Caparon MG, Geist RT, Perez-Casal J, Scott JR (1992) Регулирование вирулентности в среде стрептококков группы A : транскрипция гена, кодирующего белок M, стимулируется углекислым газом. J Bacteriol 174: 5693–5701.
    39. 39. Hondorp ER, McIver KS (2007) Реглон вирулентности Mga: инфекция там, где трава зеленее. Мол микробиол 66: 1056–1065.
    40. 40. Ristroph JD, Ivins BE (1983) Разработка антигенов Bacillus anthracis в новой определенной культуральной среде.Заражение иммунной 39: 483–486.
    41. 41. Джейнс Б.К., Стибиц С. (2006) Обычная безмаркерная замена гена в Bacillus anthracis . Инфекция иммунной 74: 1949–1953.
    42. 42. Bongiorni C, Stoessel R, Perego M (2007) Отрицательная регуляция споруляции Bacillus anthracis семейством фосфатаз Spo0E. J Bacteriol 189: 2637–2645.
    43. 43. Миллер Дж. Х. (1972) Эксперименты в молекулярной генетике. Колд-Спринг-Харбор, Нью-Йорк: Лаборатория Колд-Спринг-Харбор.С. 352–355.
    44. 44. Wilson AC, Hoch JA, Perego M (2008) Экспрессия гена вирулентности не зависит от регулируемого ResDE контроля дыхания в Bacillus anthracis . J Bacteriol 190: 5522–5525.
    45. 45. Maeda S, Omata T (1997) Субстрат-связывающий липопротеин цианобактерии Synechococcus sp. штамм PCC 7942 участвует в транспорте нитратов и нитритов. J Biol Chem 272: 3036–3041.

    «Транспортер - как форсаж, все взрослые»

    «Транспортер » - каскадерская хореография и автомобильные погони - были настолько хороши, что положили начало карьере Джейсона Стэтхэма и заставили меня в подростковом возрасте купить BMW.Я не уверен, что было более значительным вкладом в культуру. Ты будешь судьей.

    (Добро пожаловать в Jalopnik Movie Club , где мы смотрим на автомобили в фильмах и фильмы об автомобилях, и вы пишете все свои горячие моменты. На этой неделе мы рассматриваем The Transporter , фильм о том, как это круто, если вы незаконно перевозите вещи, если это не контейнер, полный людей, и вы не главный герой.)

    Я вырос в том, что мне нравится считать ренессансом боевиков, с отличными фильмами как The Bourne Identity , The Matrix , Hero , The Boondock Saints , Миссия невыполнима , GoldenEye , Ronin , Charlie's Angels , And The Fast, Furious , Blade , Kill Bill и многие другие.Да, в 80-е было Крепкий орешек, Робокоп, Пришельцы, Терминатор и еще больше, но это было следующее десятилетие, когда мы действительно потеряли это дерьмо, прежде чем франшизы о супергероях и волшебниках полностью доминировали в кино.

    Но одним из краеугольных камней моего детского просмотра фильмов был The Transporter, фильм 90-х годов, за исключением года его выхода, то есть 2002 года.

    Моей первой машиной была Honda Civic Coupe 2007 года выпуска с автоматической коробкой передач. на выбор сильно повлияли мои родители.Как только я стал помощником менеджера сети быстрого питания, над которой я работал в возрасте 17 лет (навыки, которые естественным образом переводятся в работу в ночную смену на Ялопнике), я бросил этот Civic на BMW 325ci 2003 года выпуска с ручным управлением, удовлетворив свою, по общему признанию, скромную. мечтаю о владении бмв. У меня было, черт возьми, превратилось в .

    G / O Media может получить комиссию

    Эта мечта частично родилась из фильмов Пирса Броснана о Джеймсе Бонде, где Бонд водил Z3, 7 Series, а затем Z8, и еще большее влияние на меня оказал The Transporter 735i.Как ни странно, переход на Audi в более поздних фильмах не оказал большого влияния.

    Насколько хороша сама по себе серия E38 7, Transporter действительно помогает ее продать. Мало того, что Фрэнк Мартин, сказал Транспортер, явно крутой парень, фильм также старается показать, насколько он ценит и уважает свою машину, постоянно поддерживая ее в чистоте и должным образом настроенной. Обработка автомобиля в фильме произвела на меня большее впечатление, чем если бы я просто увидел проезжающую по улице.

    Фрэнк тоже умеет на нем водить. Последовательность начального ограбления банка не только подтверждает его навыки, но и демонстрирует, насколько хорошо E38 выглядит под низким углом, как здорово он звучит, когда вы набираете обороты, насколько полезным может быть управление неэффективным исполнительным седаном и как Глупый этот фильм готов быть с манерным французским полицейским и неудобным прыжком с моста.

    Если вы не в курсе, The Transporter рассказывает о бывшем военном по имени Фрэнк, одержимом своими собственными придуманными правилами, который терроризирует Францию, перевозя практически все, что угодно, на его модном BMW.На второй работе в фильме он нарушает свои собственные правила и попадает в ловушку, пытаясь остановить заговор с целью переправить 400 человек в Европу в транспортном контейнере.

    Если вернуться к этому фильму, откроется новый слой комедии, который я не помнил в детстве. Очевидно, французский инспектор всегда был великолепен, но есть некоторые сцены, которые я пропустил, например, когда Фрэнк практически вырывается из бирюзовой рубашки-поло, свободных белых слаксов и сандалий и пытается серьезно поговорить с Лаем о том, что кучка людей продано в контейнере для хранения, и все это, я думаю, на самом деле предназначено для смеха, учитывая, что он украл одежду.Или есть сцена, в которой Лай пытается всерьез сказать, что у Джейсона Стэтхэма было «доброе лицо», когда она лгала о том, что подобрала его ночью на обочине дороги.

    Этот фильм также имеет стильный оттенок помимо великолепной хореографии, такой как использование «трассирующих» снарядов каждый раз, когда стреляет ружье, некоторые нестандартные ракурсы, несколько захватывающих сцен действия и абсолютно невероятный саундтрек, который все, вероятно, учтено в том, насколько впечатлительным я был в детстве в этом фильме.Сцена драки на вилле после взрыва его машины до сих пор одна из лучших, которые я когда-либо видел.

    К сожалению, взросление также показало новый неприятный свет на жестокое обращение с Лаем практически всеми в этом фильме, насколько странной является сцена, где Фрэнк отбивается от группы парней, покрывая свое голое тело маслом, как ленивая часть развития сюжета, и я полностью забыл финал, в основном потому, что он не приземляется с каким-либо существенным воздействием после того, как последовательность боевых действий грузовика явно поднята из Raiders Of The Lost Ark .

    В конечном счете, Transporter - это лысый парень средних лет, который много ездит на BMW, что звучит как история среднего владельца BMW, но превращается в фаст-фуд из боевика с промасленными ... кулачные бои, отличные погони, забавные персонажи и впечатляющие трюки.

    По сути, это как The Fast And The Furious , но для человека, который заботится о немецком представительском седане в своем гараже так же, как подросток заботится о своей разбитой Mazda RX7.И может быть 401 (k).

    Я иду послушать саундтрек к этому фильму, так что это все от меня. Теперь давайте послушаемся тех из вас, кто прислал по электронной почте свои мысли, мнения и горячие мысли о The Transporter :

    Jalopnik Заместитель редактора Майкл Баллабан:

    Как вы хорошо знаете, я глубоко уважаю и восхищаюсь всем, что вы делаете. Я уверен, что идеальные и прекрасные читатели, которым нравится серия фильмов Jalopnik Movie Club, чувствуют то же самое.

    Вы недавно говорили о Transporter в офисе.Я, как и этот отвратительный занудный человек, сразу же вмешался в разговор, который у вас был с Кристен, и грубо пожаловался на то, что BMW 7 серии в фильме на самом деле не существовало. Ну, вроде как. Только для фильма. Вы сказали мне послать вам этот маленький фактоид по электронной почте.

    Вот тот факт.

    Автомобиль, использованный в фильме, был BMW 750il с двигателем V12, согласно TheTransporterMovie.net , но оснащенный механической коробкой передач от BMW для «боевых» целей (в фильме его называли 735i, но предположительно он действительно была модель V12).BMW так и не выпустила другого механического двигателя V12 7-й серии. Но они должны были это сделать.

    Ладно, вот и все.

    Всегда с любовью и благословениями,

    Ballaban

    Роберт Х .:

    Я подумал, что фильм отлично справился с изображением настоящих спальных машин. Негабаритные немецкие седаны с несколькими сделанными со вкусом модификациями. Позже в сериале он попадает на территорию Bond Q Branch, но наблюдать за тем, как Audi переворачивается в оригинале, было потрясающе.

    От фильма под названием Transporter я ожидал большего вождения. Но, чтобы компенсировать отсутствие визга шин на поворотах, к счастью, сценаристы порадовали нас множеством милых хореографических боев. Как только вы снизите свои ожидания, этот фильм станет таким, какой он есть на самом деле, просто приличным боевиком, и вы будете рады, что не потратили свои деньги в 2002 году.

    Не поймите меня неправильно, Фрэнк Мартин, который авторы сочинили апелляции к моему сдержанному ОКР. Водитель, который держит свою машину в чистоте, тщательно следит за расписанием, одевается в хорошо сидящую одежду и обладает некоторыми навыками вождения.Это полностью моя сумка. Вероятно, помогает то, что Стэтхэм имеет мимолетное сходство с мистером Клином.

    Но после того, как его БМВ взорвался, и он сел на Мерседес, а затем на другие маленькие французские автомобили, я чуть не заснул от того, насколько это было предсказуемо.

    Мне особенно понравились боевые сцены. В некотором смысле Стэтхэм был почти как Джеки Чан или Джет Ли из бедняков, с тем, насколько творчески он проявлял себя в окружении превосходящих людей. Если бы вы сказали мне, что во вторник вечером я бы наблюдал за тем, как дюжина мужчин смазывают себя маслом, я бы рассмеялся, но Стэтхэм делает почти правдоподобным наблюдение типа: «Да, это совершенно правдоподобно.

    И ему столько раз приходилось снимать рубашку? Это похоже на то, как если бы у Стэтхэма был наездник, которого нужно показывать без рубашки хотя бы две минуты экранного времени, иначе он ходит.

    Exage03040:

    В этом фильме мы видим следующее: женщина пьет через соломинку, мужчина ест руками, а инспектор пьет из чашки.

    «Chacun voit midi à sa porte…» Я по-другому вспомнил «Транспортер», когда впервые увидел его много лет назад. Этот фильм, в частности, закрепил за собой боевик Джейсона Стэтхэма.Это было его происхождением, поскольку я впервые стал свидетелем его боевых искусств. Хотя это странно. Я помню, как был очарован этим фильмом, когда впервые посмотрел его. И все же этот конкретный просмотр я был довольно шокирован. Думаю, он поразил меня в подходящем возрасте, когда он был выпущен, потому что это не совсем хороший фильм.

    Джейсон играет жесткого колесника Фрэнка Мартина; Перевозчик, который доставит что угодно и где угодно, всего лишь с несколькими вопросами и крупной оплатой. Раньше я вспоминал Фрэнка как этого загадочного и крутого персонажа, но теперь он кажется чрезвычайно одномерным.После, возможно, трофеи многих фильмов Стэтхэма. К сожалению, большинство персонажей страдают стереотипными комплексами и довольно съеживаются от достойных выступлений, за исключением Франсуа Берлеана в роли инспектора Таркони. Я все еще верю, что он выполнил свою роль.

    BMW 7-й серии поляризует этот фильм. С модификациями трюков и руководством для загрузки! Он очень хорошо представлен на экране, и я считаю, что это был лучший способ описать личность Фрэнкса аудитории, несмотря на то, что это был неясный способ добиться этого.Сам по себе автомобильный экшен определенно уравновешен по сравнению с взрывными фильмами, которые развивались в стиле «Быстрого и смешного». Как бы то ни было, в фильме есть несколько хороших сцен и сценариев в этой области, и это, безусловно, было приемлемо для своей эпохи.

    По общему признанию, мне нравится посылка, но в большой схеме сюжет находится на странной стороне с такими же странными встречами. Всегда кажется, что выбирают план Б или В, потому что судороги позволяют более интересным боям или побегам.Эти велосипедные педали - чистое волшебство на этом смазанном маслом полу! Так же и фермер с идеальным самолетом для прыжков с парашютом [и парашютом]. Не забудем также Metal Gear Solid Nikita, похожий на ракету, которая взрывает печь в доме Франков. Я полагаю, «Impossible n’est pas français».

    Movie: Это одна из ранних работ Стэтхэма, и она показывает ускоренные сцены боя, быстрые монтажные кадры и довольно деревянную игру. Это фильм, который, как мне кажется, не выдержал так хорошо, и в целом он не был особенно сильным.C это так.

    Car Movie: В нем есть приличный выбор и сценарии с участием транспортных средств. Это не совсем звездно в этом плане, поскольку различные сцены вызывают заметные перебои в отношении транспортных средств. Тем не менее, черный BMW 7 был фантастическим выбором. Я поставлю ему B.

    Rude Negro:

    The Transporter - Чертовски хороший фильм.


    И это завершает обзор Jalopnik Movie Club на этой неделе! Спасибо всем, кто написал свои дубли, и я призываю вас сделать это на следующей неделе!

    На следующей неделе мы рассмотрим Чувак, где моя машина? , который, вероятно, все видели, но, к сожалению, доступен только для аренды или покупки.В любом случае, соберитесь с мыслями и напишите свое мнение и горячие моменты Джастину на jalopnik dot com.

    А пока не расскажите о достоинствах и недостатках Transporter и всей его безнадежности, и до встречи на следующей неделе!

    MacB ABC транспортер представляет собой димер, активность АТФазы и макролидсвязывающая способность которого регулируются мембранным гибридным белком MacA

    Грамотрицательные бактерии используют специализированные механизмы для перемещения лекарств и белковых токсинов через внутреннюю и внешнюю мембраны, состоящие из трех частей. комплекс, состоящий из вторичного или первичного активного переносчика внутренней мембраны (IMP), слитого белка периплазматической мембраны и канала внешней мембраны.Мы исследовали сборку и функцию системы MacAB / TolC, которая придает устойчивость к макролидам в Escherichia coli . Слитый с мембраной белок MacA не только стабилизирует трехкомпонентную сборку, взаимодействуя как с белком внутренней мембраны MacB, так и с белком внешней мембраны TolC, но также играет роль в регулировании функции MacB, очевидно, увеличивая его сродство как к эритромицину, так и к АТФ. Анализ кинетического поведения гидролиза АТФ показал, что MacA способствует и стабилизирует АТФ-связывающую форму переносчика MacB.С помощью недиссоциирующей масс-спектрометрии, аналитического ультрацентрифугирования и атомно-силовой микроскопии мы впервые однозначно установили димерную природу неканонического переносчика ABC, MacB, который имеет N-концевой нуклеотид-связывающий домен. Структурные исследования транспортеров ABC показывают, что АТФ связывается между парой нуклеотидсвязывающих доменов, чтобы стабилизировать конформацию, в которой сайт связывания субстрата обращен наружу. Следовательно, наши данные предполагают, что в присутствии АТФ такая же конформация MacB продвигается и стабилизируется MacA.Таким образом, MacA будет способствовать доставке лекарств посредством MacB к TolC, усиливая связывание лекарств с ним и индуцируя конформацию MacB, которая примирована и компетентна для связывания TolC. Наши структурные исследования - важный первый шаг в понимании того, как собирается трехчастный комплекс.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *