Масса газ 2705: ГАЗ-2705 (ГАЗель) характеристики и цена, фотографии и обзор

Содержание

ГАЗ-2705 технические характеристики, двигатель и расход топлива, фото и размеры

ГАЗ-2705 сошел с конвейера в далеком 1995 году, и до сих пор его технические характеристики заставляют радоваться людей, любящих свою страну и то, что она делает. В то время «Газель» была надеждой российского автопрома и была незаменима. ГАЗ-2705 отличался своей надежностью, он быстро полюбился людям и стал лидером продаж в своем классе.

Назначение

Автомобиль «Газель» имеет большое количество модификаций и является достаточно непривередливым как к качеству используемых запчастей, так и к условиям эксплуатации. К его модификациям относятся:

  1. «Газель-Бизнес» обладает закрытым кузовом, который считается грузовым отсеком.
  2. «Газель-Фермер» — модификация, в которой вместо задней грузовой части, присутствует соединяемый прицеп, что делает это транспортное средство похожим на пикап.
  3. Микроавтобус «Газель» оснащается остеклением в задних окнах и дополнительными пассажирскими местами вместо грузового отсека.
  4. АСМП «Газель» стоит на использовании в скорой помощи, оснащена всевозможной электроникой для поддержания жизни человека.

Автомобиль присутствует даже в полноприводных версиях, что дает вам возможность подобрать его под свои нужды и удовлетворить технические потребности даже самого привередливого покупателя.

«Газель» сохранила свои небольшие размеры и по сей день. Автомобиль обладает цельным кузовом. В базовой модели присутствуют две обычные двери, одна раздвижного типа, которая находится с правой стороны автомобиля, и задняя дверь, состоящая из двух створок для открывания. Окна в грузовом отсеке ставятся только в пассажирских версиях ГАЗ-2705. Передняя часть округлая, что делает скоростные характеристики автомобиля довольно приемлемыми в своем классе.

Рестайлинговые изменения

С момента схода первого ГАЗ-2705 с конвейера он подвергся довольно серьезным изменениям. Изначально автомобиль имел очень большое количество слепых зон, что делало его опасным на дороге. Это происходило из-за неправильной установки зеркала заднего вида. С течением времени эта ошибка была исправлена путем увеличения зеркала и улучшения угла его наклона, и автомобиль приобретал более стильный и законченный вид.

«Газель» вооружилась мощной оптикой в виде капель взамен невзрачным базовым устройствам. Бампер, изготовленный из пластика, также придавал ГАЗ-2705 большую солидность, что подогревало интерес к данной машине.

Изначально в базовой комплектации автомобиля место водителя было довольно слабо сбалансировано в плане удобства, и затяжные поездки давались с трудом. Инженеры ГАЗ-2705 пересмотрели возможности оснащения водительского сиденья и сделали его более удобным, добавив правильные размеры для подголовника и включив дополнительные подлокотники.

Технические характеристики

Фургон с кузовом цельнометаллической конструкции, вместимостью 6, 9 и 11 кубометров. Характеристики:

  • колесная формула – 4 х 2;
  • грузоподъемность – 1350 кг;
  • снаряженная масса – 2000 кг;
  • нагрузка на переднюю ось – 1050 кг;
  • на заднюю ось – 950 кг;
  • полная масса машины – 3500 кг;
  • длина автомобиля, мм – 5500;
  • высота, мм – 2274;
  • ширина, мм – 2500;
  • длина грузового отделения, мм – 3214;
  • ширина грузового отделения, мм – 1719;
  • высота грузового отсека, мм – 1515;
  • клиренс (дорожный просвет) – не менее 170 миллиметров;
  • база колесная, мм – 2900;
  • ширина колеи – колес передних/задних – 1700/1560 мм;
  • максимальная скорость автомобиля – 115 км/час; средний расход топлива в городском режиме – 11,5 л;
  • передняя подвеска – зависимая, на двух полуэллиптических рессорах продольного расположения, со штангой-стабилизатором, обеспечивающей поперечную устойчивость; амортизаторы передней подвески телескопические на гидравлике;
  • задняя подвеска – зависимая, на двух полуэллиптических рессорах, усиленных малым рессорным блоком, с балкой поперечной устойчивости; амортизаторы гидравлические, телескопической конструкции;
  • тормоз передний – дисковый невентилируемый;
  • задний тормоз – барабанный, саморегулирующийся;
  • система тормозная – двухконтурная, независимая, диагонального действия;
  • механизм стояночного тормоза – кулачковый эксцентрик на задних колесах.

Модель ГАЗ-2705, характеристики которой полностью соответствуют требованиям экологии “Евро-3”, небольшими партиями отправляется за рубеж.

Силовая установка

На автомобиль ГАЗ-2705 устанавливается двигатель марки “ЗАЗ-406” Заволжского моторного завода со следующими характеристиками:

  • тип – бензиновый, внутреннего сгорания;
  • питание – инжекторный впрыск;
  • число цилиндров – 4;
  • расположение – рядный;
  • число клапанов – 16;
  • мощность, максимальная – 145 л. с. при 5200 оборотов/мин;
  • диаметр цилиндра, мм – 92;
  • степень сжатия – 9,3;
  • ход поршня – 86 мм;
  • охлаждение – водяное;
  • масса – 192 кг.

Двигатель ГАЗ-2705 конструктивно надежный, обладает достаточно продолжительным ресурсом, требует минимального профилактического обслуживания. Единственным недостатком мотора является его система охлаждения, часто приходится менять термостат. В остальном силовой агрегат нареканий не вызывает.

Недавно завод перешел на оснащение модели ГАЗ-2705 двигателями марки CUMMINS.

Расход топлива ГАЗ 2705 на 100 км.

Показатель расхода топлива у ГАЗ-2705 зависит от типа устанавливаемого двигателя. При скорости 60 км/час он составляет:

  • «ЗМЗ-4063.10» – 10,5 л/100 км ;
  • «ЗМЗ-40522» – 9,5 л/100 км;
  • «ГАЗ-560» – 8,5 л/100 км;
  • «ГАЗ- 5601» – 8 л/100 км;
  • «ГАЗ- 5602» – 8 л/100 км;
  • «УМЗ-4215.10» – 11 л/100 км;
  • «УМЗ-4215.10-10» – 11 л/100 км;
  • «УМЗ-4216» – 11 л/100 км.

При скоростном режиме в 80 км/час потребление топлива увеличивается в среднем на 2-3 л.

Трансмиссия

Все автомобили ГАЗ-2705 комплектуются механической пятиступенчатой коробкой передач с полной синхронизацией скоростей. Агрегат представляет собой усовершенствованную версию четырехступенчатой КП от “Волги ГАЗ-24”.

Устройство

Кузов ГАЗ-2705 выступает в качестве несущей конструкции. Специальная перегородка делит внутреннее пространство на кабину и грузовой отсек. Для посадки водителя и пассажиров используются боковые двери. Для загрузки отлично подойдут распашные двухстворчатые двери. Отдельные модификации также оборудуются дополнительной сдвижной боковой дверью. Благодаря антикоррозийной обработке ресурс эксплуатации кузова при нормальных условиях составляет 9-10 лет.

Для комфортного движения пассажиров и водителей в салоне имеются все условия. Панель приборов сделана из антибликового пластика, отвечающего мировым стандартам по травмобезопасности. Сиденья можно настроить по наклону спинки и степени отдаленности от приборной панели. Холода не страшны «Газели», поскольку автономные отопители в автомобиле работают очень хорошо. В жаркое время вентиляция обеспечивается за счет открывающихся боковых окон. Последние версии ГАЗ-2705 оснащаются системой климат-контроля. В базовой комплектации также поставляется магнитола. Индикаторы и контрольные приборы установлены удачно и не мешают в управлении.

Размер автомобиля

Габариты и размеры Газели составляют 5500 мм на 2500 мм. Машина довольно широкая из-за рестайлинговых зеркал, которые она приобрела в современном виде. Основное место в ГАЗ-2705 занимает грузовая часть, и поэтому автомобиль обладает отличной вместимостью, что также делает его еще более популярным в своем классе.

Расстояние от дороги до нижней точки днища — 170 мм, а в случае наличия полного привода — 190 мм. Объем грузового отсека в автомобиле ГАЗ-2705 равен 9 м³. Грузоподъемность в модели «грузовой фургон» равняется двум тоннам. Это позволяет хорошо справляться с перевозками небольших грузов на довольно большие расстояния. Грузоподъемность в модели «комби», в случае, когда масса самого автомобиля меньше, равна примерно 1350 кг.

В автомобилях этого класса в главные характеристики входят как грузоподъемность, так и высота погрузки. Эта величина во всех комплектациях и моделях авто составляет 725 мм. Это является довольно хорошим показателем, так как обеспечивает более легкую возможность загрузки.

Вместимость

В кабине Газели мало места, туда могут поместиться лишь три человека, один из которых — водитель. Два пассажирских места соединены между собой и имеют подголовники. В салоне автомобиля применялся жесткий пластик, который отличается своей надежностью и способностью выдерживать сильнейшие нагрузки от перепадов температуры.

Также одним из материалов отделки салона является ткань. В некоторых моделях ГАЗ-2705 в кабине присутствует второй ряд сидений, что добавляет два посадочных места в самой кабине. Кабину от грузового отсека отделяет перегородка, сделанная из металла.

Модификации

Марка “Газель” уже давно стала символом коммерческого транспорта России. И поскольку специфика малотоннажных перевозок требует разнообразия транспортных средств, на базе модели ГАЗ-2705 создаются отдельные модификации популярного фургона.

Помимо уже упомянутых машин “Комби”, с 2010 года Горьковский автозавод выпускает “ГАЗель-Бизнес”, основанный на платформе 2705. Кроме коммерческого перевозчика, были разработаны спецавтомобили: машина “скорой помощи”, инкассаторский бронированный автомобиль, мобильная медицинская лаборатория, машина гидротехнических служб.

Ремонт

В случае если автомобиль ломается на законном сроке гарантии, то производитель, скорее всего, без проблем займется его починкой. Если же гарантийный срок обслуживания вашего авто подошел к концу и произошла непредвиденная поломка, существует большое количество умельцев, которые специализируются на ремонте «Газели», и они без труда смогут устранить возникшие у вас поломки.

В основном из-за большого срока эксплуатации автомобиля его главной проблемой становится коррозия. Это последствие межсезонной эксплуатации в суровых российских условиях. Некоторым людям неприятно видеть свою любимую машину стоящей и ржавеющей. Проблема с коррозией решается довольно легко, если уровень специалиста, работающего над вашим автомобилем, соответствует необходимым требованиям.

«Газель» является хорошим выбором для людей, которые решили связать сферу своей деятельности с грузоперевозками или же экскурсионными турами. Благодаря вместительному багажному отделению в грузовых версиях и большому количеству удобных мест в пассажирских версиях, автомобиль без труда справится с этими задачами.

Количество отзывов Оставить отзыв

Сортировать по: Самые последниеНаивысший баллНаиболее полезноХудшая оценка

Будьте первым, чтобы оставить отзыв.

Проверенный отзыв

{{{ review.rating_title }}} Показать еще Оставить отзыв

Технические характеристики Газ 2705 — Бибипедия

Технические характеристики Газ 2705: мощность, расход топлива на 100 км, вес (масса), дорожный просвет (клиренс), радиус разворота, тип трансмиссии и тормозов, размеры кузова и шин.

Характеристики 2705 фургон с 2010 года

Модификация Мощность, кВт(л.с.)/об Расход топлива (средний), л/100 км Вес (масса), кг
2.8 TD MT 4×4 (120)/3200
11
2.8 TD MT (120)/3200 10
2.9 MT 4×4 (107)/4000 15
2.9 MT (107)/4000 13

Характеристики 2705 kombi с 2010 года

Модификация Мощность, кВт(л.с.)/об Расход топлива (средний), л/100 км Вес (масса), кг
2.8 TD MT 4×4 (120)/3200 11
2.8 TD MT (120)/3200 10
2.9 MT 4×4
(107)/4000
15
2.9 MT (107)/4000 13

ФУРГОН ГАЗ 2705 ГАЗЕЛЬ — ГАЗель

Автомобиль ГАЗ 2705 принадлежит к легендарному семейству Газелей, едва ли не единственному успешному проекту отечественного автопрома. Фургон почти вытеснил с рынка своего единственного российского «одноклассника» УАЗ 452 «буханка» и его преёмников. ГАЗ 2705 добился по-настоящему значимого коммерческого успеха на рынке и продолжает пользоваться популярностью.

Содержание

  1. Кузов и интерьер
  2. Двигатель и трансмиссия
  3. Модификации фургона «Газель»

Кузов и интерьер

О том, что кузов автомобиля 2705 относится к типу фургон, говорит вторая цифра в названии модели. А первая цифра из этого обозначения относит автомобиль к категории тех, чья полная снаряженная масса составляет от 1200 до 2000 килограммов. Третья и четвёртая цифры — просто заводской номер модели.

Кузов Газели фургона — цельнометаллический. Он не является несущим и устанавливается на раме. Габаритные размеры автомобиля при этом составляют (длина — ширина — высота соответственно) 5500×1966×2274 мм. В 2003 году фургон получил новые рестайлинговые зеркала, что существенно улучшило обзорность. С учётом этих зеркал ширина составляет 2500 мм. Грузоподъёмность ГАЗ 2705 составляет 1350 кг, а снаряженная масса — 2000 кг.

Рассмотрим другие характеристики грузовика.

АспектыЧисловые показатели
Багажникобъёмом 9 кубических метров
Колёсная база2900 мм
Клиренс170 мм
Радиус поворота5,5 м
Углы свеса нагруженного автомобиляпередний — 22 градуса, задний — 18 градусов
Колёсная формула в базовой модификации4×2

 

Кузов автомобиля модели 2705 имеет четыре двери. Две двери переднего ряда распашные, обеспечивают доступ в салон водителю и передним пассажирам. Дверь второго ряда сдвижная и расположена справа по ходу движения машины. Она обеспечивает доступ в салон ко второму ряду сидений или в грузовой отсек. Задняя дверь фургона распашная, двустворчатая, открывающаяся на 180 градусов.

Нижний край задней двери не образует порога перед грузовым отсеком, и груз можно просто вдвинуть в отсек по специальным рельсам высотой 4 мм. Погрузочная высота при этом составляет всего 725 мм, что 275 мм меньше, чем, например, у бортовой Газели.

Двигатель и трансмиссия

Базовой энергетической установкой, которая изначально ставилась на фургон модели 2705, является 4-цилиндровый бензиновый карбюраторный двигатель ЗМЗ-402.10. Его цилиндры расположены в ряд. Этот надёжный, многократно проверенный при эксплуатации в различных условиях, неприхотливый двигатель широко распространён в автомобилях Горьковского автомобильного завода. Технические характеристики этого мотора:

  • объём 2,45 литра;
  • мощность 100 л. с.;
  • штатная температура охлаждающей жидкости 90 С.

Технические характеристики ГАЗ 2705 с таким мотором позволяют ему достигать максимальной скорости 115 км/час. Для автомобиля ГАЗ 2705 расход топлива на 100 км в городе равен примерно 13,5 литрам. Объем бака 70 литров. Электрическая схема — однопроводная, использующая ток 12 В. Отрицательные контакты аккумуляторной батареи и потребляющих устройств соединены с «массой» автомобиля.

Трансмиссия фургона механическая, 5-ступенчатая. Все передние передачи синхронизированы. Двухвальная карданная передача имеет промежуточную опору. Сцепление сухое, однодисковое, имеет гидравлический привод. Передняя и задняя подвеска имеют по две продольные листовые рессоры, гидравлические телескопические амортизаторы. Задняя подвеска снабжена стабилизатором поперечной устойчивости. Шины имеют размерность 175 R16.

Автомобиль оборудован двухконтурной тормозной системой с гидравлическим приводом и вакуумным усилителем. Тормоза передних колёс дисковые, а задних колёс — барабанные.

Модификации фургона «Газель»

За беспрецедентно долгий для российского автопрома (более чем 20-летний) срок выпуска автомобиля Газель 2705 в свет вышли свыше 60 модификаций этого фургона. Одних только двигателей известно более десятка вариантов, включая дизель и моторы иностранного производства. Почти с самого начала выпуска модели (с 1996 года) известна полноприводная модификация 4×4.

Постоянный полный привод автомобиля Газель 27057 обеспечивает ведущий передний мост и механическая, двухступенчатая раздаточная коробка. Она снабжена понижающей передачей и межосевым дифференциалом с принудительной блокировкой. Вариант 4×4 имеет повышенный до 190 мм клиренс и увеличенный до 7,5 метров радиус разворота. Возможность передвижения ГАЗ 27057 по дорогам любого класса и даже по бездорожью имеют несомненную ценность в российских условиях и определяют неизменно высокую востребованность модификации.

Другой важный признак, отличающий машины по компоновке салона, отражается в последних двух цифрах 7-значного номера модификации. ГАЗ 2705 344 — это заднеприводная дизельная модификация с трёхместным салоном, а ГАЗ 2705 264 — заднеприводная бензиновая с семиместным. Из последних трёх цифр обозначения этой модели цифра 2 означает бензин, а 64 — семь мест в салоне. Семиместный салон отличается наличием второго ряда из четырёх сидений. Доступ к ним осуществляется через сдвижную дверь правого борта. Размеры грузового отсека при таком варианте значительно уменьшаются, его объём падает до 5,6 кубометра.

Пассажирский салон отделяется от грузового отсека непроницаемой перегородкой, для обогрева пассажиров второго ряда предусмотрена дополнительная печка. Некоторые модификации (например, ГАЗ 27057-90) получали надставную пластиковую крышу, увеличивавшую габариты высоты автомобиля до отметки 2274 мм. Это обеспечивало возможность ехать в автомобиле стоя.

В 2003 году модель пережила рестайлинг. Изменились зеркала, решётка радиатора. Передние фонари приобрели каплевидную форму, что сделало Газель значительно симпатичнее.

Салон по материалам и эргономике даже после рестайлинга остался довольно спартанским. Жёсткий пластик, интенсивно выцветающий на солнце, отсутствие подлокотников у водительского сидения не смущает владельцев Газели. Они любят этот автомобиль не за опции и комфорт, а за простоту и неприхотливость.

Технические характеристики ГАЗель Бизнес в АВТОЦЕНТРГАЗ ДУЭТ-1 в городе Севастополь

Тип двигателя Бензиновый, 4-тактный, вспрысковый Битопливный (бензин+пропан), 4-тактный Дизельный, с турбонаддувом и охладителем наддувочного воздуха Бензиновый, 4-тактный, впрысковый
Количество цилиндров и их расположение 4, рядное 4, рядное 4, рядное 4, рядное
Диаметр цилиндров и ход поршня,мм 100×92 100×92 94×100 96,5х92
Рабочий объем цилиндров, л 2,89 2,89 2,8 2,69
Степень сжатия 9,2 9,2 16,5 10

Номинальная мощность, нетто кВт (л.с.)

при частоте вращения коленчатого вала, об/мин

78,5 (106,8)


4000

73,4 (99,8) на бензине
73,4 (99,8) на газе*

4000

88,3 (120)


3600

78,5 (106,8)


4000

Максимальный крутящий момент, нетто, Н*м (кгсм)

при частоте вращения коленчатого вала, об/мин

220,5 (22,5)

2500

220,5 (22,5) на бензине
205,8 (21,0) на газе*

2500

270 (27,5)

1400-3000

220,5 (22,5)

2350±150

Порядок работы цилиндров 1-2-4-3 1-2-4-3 1-3-4-2 1-2-4-3
Частота вращения коленчатого вала в режиме холостого хода, об/мин
минимальная
повышенная

800±50
3000±50

800±50
3000±50

750±50

4500

800±50
3000

Направление вращения коленчатого вала (наблюдая со стороны вентилятора) правое правое правое правое
Запас хода от одной заправки при движении на всех типах топлива 400 870 475
ЭБУ один единый один
Контрольный расход основного топлива при движении со скоростью:
60 км/ч, л/100км
80 км/ч, л/100км


10,5
13


10,7
13


8,5
10,3


9,8
12,1

Контрольный расход газа при движении со скоростью:
60 км/ч, куб.м/кг
80 км/ч, куб.м/кг


13
15



Количество газовых баллонов, шт. 1
Емкость газового баллона, л 88
Общая емкость системы газовых баллонов, куб.м/кг 88
Запас хода от одной заправки на основном топливе, км 400
Запас хода от одной заправки на газу, км 345
Суммарный запас хода от одной полной заправки, км 745

ГАЗ 2705 Газель технические характеристики: двигатель, расход топлива


Грузопассажирский автомобиль ГАЗ-2705 появился в 1994 году, когда Горьковский автозавод начал выпускать малотоннажные машины с допустимой массой не более 3500 кг. Новая модель сразу завоевала популярность среди автовладельцев и бизнесменов, нуждающихся в экономичных и маневренных перевозках. Технические характеристики «Газели» ГАЗ-2705 позволяют использовать автомобиль как в городе, так и в сельской местности. За счет того, что рамное шасси прочное и износостойкое, машина легко проходит по любым дорогам.

Устройство автомобиля «Газель»

Марка «Газель» имеет много модификаций. На базе основной модели создано более 60 вариантов машин, отличающихся друг от друга внешними данными, техническими характеристиками, внутренним оснащением. Среди них – кареты скорой помощи, микроавтобусы, инкассаторские бронемашины, автолаборатории.

Автомобиль ГАЗ-2705 первого поколения выглядит скромно. Это фургон обтекаемой формы, с цельнолитым металлическим кузовом. Конструкция «Газели» оснащена четырьмя дверьми:

  • две из них — классического типа, расположены впереди;
  • одна сдвижная – сбоку по правому борту;
  • одна двустворчатая – сзади.

В грузовой части отсутствует остекление.

Грузовая часть ГАЗ-2705

Изначально внешний вид автомобиля был строгим и незаурядным: простые прямоугольные фары, штатная радиаторная решетка, боковые зеркала, оставляющие слепые зоны. Со временем инженеры-конструкторы модернизировали «Газель»: автооптика приобрела каплевидную форму, решетка радиатора видоизменилась, боковые зеркала увеличились за счет появления интегрированных поворотников.

Салон ГАЗ-2705

Внутренний салон стандартной машины ГАЗ-2705 тоже был незамысловатым. Он отличался прямыми формами и простотой расположения деталей системы управления. В кабину, где находилось сдвоенное пассажирское кресло, помещалось три человека, включая водителя.

Постепенно интерьер улучшили. В нем появилось много свободного места и дополнительные сиденья. Особенно это характерно для грузопассажирской модели «Комби». Место водителя стало более комфортабельным, благодаря правильным пропорциям подголовника и дополнительным подлокотникам.

Габариты «Газели»

Что касается размеров автомобиля ГАЗ-2705, то первоначальная длина кузова была равна 5500 мм, ширина без зеркал – 1966 мм, а высота – 2200 мм. Многие модели более высокие, за счет надставной пластиковой крыши.

Дорожный просвет «Газели» составляет 170 мм для базового автомобиля, и 190 мм – для полноприводных машин. Колея передних колес – 1700 мм, колея задней оси – 1560 мм. Радиус поворота автомобиля – 5,5 м. Это меньше, чем у большинства других «легковушек».

Сегодня ГАЗ-2705 «Газель» выпускается в третьем поколении после двух серьезных модернизаций.

Габариты ГАЗ-2705

Технические характеристики автомобиля

На «Газели» расход топлива зависит от многих факторов, и в первую очередь – от типа двигателя. Согласно техническим характеристикам, ГАЗ-2705 позволяет устанавливать бензиновый или дизельный мотор.

Основные технические характеристики ГАЗ-2705

При скоростном режиме 60 км/час показатель потребления горючего автомобиля на 100 км будет таким:

Тип двигателяПараметрыРасход топлива

 (в литрах)

Количество цилиндровИспользуемое

топливо

Рабочий объем

(в литрах)

Мощность

(л. с.)

«ЗМЗ-4063.10»4, рядный, с 2 клапанамиБензин АИ-922,311010,5
«ЗМЗ-40522»4, рядный, с 4 клапанамиБензин АИ-922,5140,59,5
«ГАЗ-560»4, рядный, с 2 клапанамиДизельное2,13958,5
«ГАЗ-5601»4, рядный, с 2 клапанамиДизельное2,131108,0
«ГАЗ-5602»4, рядный, с 2 клапанамиДизельное2,13958,0
«УМЗ-4215.10»4, рядный, с 2 клапанамиБензин АИ-922,899611,0
«УМЗ-4215.10-10»4, рядный, с 2 клапанамиБензин АИ-762,898911,0
«УМЗ-4216»4, рядный, с 2 клапанамиБензин АИ-922,8912311,0

Устройство двигателя ГАЗ-2705

Несмотря на то, что модификации автомобиля ГАЗ-2705 оснащают разными силовыми установками, стандартная грузовая модель комплектуется бензиновым двигателем «ЗМЗ-406» производства Заволжского моторного завода. Это рядный четырехцилиндровый агрегат, с жидкостным охлаждением и комплексной микропроцессорной системой управления, которая позволяет регулировать впрыск топлива и зажигание.

Двигатель ЗМЗ-406

В верхней его части находятся два распределительных вала с установкой по четыре клапана на цилиндр. Устройство отличается максимальной мощностью: 145 лошадиных сил, способствующих снижению расхода топлива и уменьшению токсичности отработавших газов.

Для повышения эксплуатационных свойств двигателя используются:

  • Инжекторный впрыск топлива электромагнитными форсунками вместо карбюраторного питания.
  • Повышенная степень сжатия из-за центрального положения свечи в камере сгорания: 9,3 вместо 8,2, как в других моделях.
  • Высокие обороты коленчатого вала.
  • Применение гидротолкателей, избавляющих от регулировки зазоров.
  • Использование полнопоточного масляного фильтра с дополнительной фильтрацией.

Коленвал ГАЗ-2705

Обладая большим ресурсом, двигатель «ЗМЗ-406» не нуждается в сложных профилактических мероприятиях.

Особенность трансмиссии

Автомобили ГАЗ-2705 укомплектованы такими основными элементами трансмиссии:

Коробка передач ГАЗ 2705

  • Механическая пятискоростная коробка передач, представляющая собой усовершенствованный вариант четырехступенчатого механизма от «Волги» ГАЗ-24.
  • Сцепление – рычажного типа, однодисковое, сухое, с гидроприводом.
  • Карданная передача – с промежуточной опорой.
  • Межосевой дифференциал с функцией принудительной блокировки.

Видео по теме: Тест-драйв ГАЗ 2705


Автомобили Газель ГАЗ-2705

______________________________________________________________________________

Технические параметры автомобилей Газель ГАЗ-2705

Автофургоны ГАЗ-2705 Газель предназначены для перевозки мелких партий грузов, автобусы — для перевозки пассажиров по дорогам с твердым покрытием.

Введено измененное оперение с косоугольными фарами повышенной мощности, что обеспечило увеличение подкапотного пространства и позволило устанавливать на все модели автомобилей ГАЗ-2705 Газель по заказу зарубежные дизельные двигатели литражом до 3 литров.

Автомобили ГАЗ-2705 Газель получили новую, более эффективную систему отопления, новую панель приборов современной формы с электроуправляемым краном отопителя и новой комбинацией приборов с электронным приводом спидометра, более надежные замки передних дверей.

В коробку передач автомобилей введен 2-конусный синхронизатор 1—2 передач, позволивший снизить усилие при переключении этих передач.

Технические характеристики автомобиля ГАЗ-2705 Газель

Модель автомобиля Газель ГАЗ-2705 — Цельнометаллический автофургон

Полная масса, кг — 3500

Масса снаряженного автомобиля, кг — 2000

База, мм — 2900

Габаритные размеры Газель ГАЗ-2705, мм:

— длина — 5500

— ширина — 2075

— высота — 2285

Колея передних колес — 1700

Колея задних колес (между серединами сдвоенных шин), мм — 1560

Дорожный просвет (под картером заднего моста при полной массе), мм — 170

Минимальный радиус поворота по колее наружного переднего колеса, м — 5,5

Максимальная скорость автомобиля на горизонтальном участке ровного шоссе, км/ч — 115

Углы свеса (с нагрузкой), град:

— передний — 22
— задний — 18

Максимальный подъем, преодолеваемый автомобилем с полной нагрузкой, % — 26

Погрузочная высота фургона, мм — 725

Объем грузового салона фургона, мм3 — 9/6

Двигатель Газель ГАЗ-2705

Модель двигателя — ЗМЗ-402

Тип — 4-тактный, карбюраторный

Число и расположение цилиндров — 4, Четырехрядное

Диаметр цилиндра и ход поршня, мм — 92х92

Рабочий объем цилиндров, л — 2,445

Степень сжатия — 6,7

Номинальная мощность, кВт (л. с.) — 66,2(90)

Максимальный крутящий момент, Н·м (кгс·м) — 173(17,6)

Порядок работы коленчатого вала — 1-2-4-3

Направление вращения коленчатого вала — Правое (наблюдая со стороны вентилятора)

Система питания — С подогревом рабочей смеси отработавшими газами

Карбюратор — К-151, К-151С

Воздушный фильтр — Сухой с картонным фильтрующим элементом

Трансмиссия Газель ГАЗ-2705

Сцепление — Однодисковое, сухое с гидравлическим приводом выключения

Коробка передач — Механическая, 5-ступенчатая с синхронизаторами на всех передачах переднего хода. Передаточные числа: I передача — 4,05; II — 2,34;
III — 1,395; IV — 0,849;V — 0,849 и задний ход — 3,51

Масса коробки передач, кг — 32

Карданная передача — Открытого типа. Имеет два вала и три карданных шарнира с игольчатыми подшипниками. Снабжена промежуточной опорой

Ведущий мост Газель ГАЗ-2705

главная передача — Коническая, гипоидная, передаточное число — 5,125 (4,556*)

дифференциал — С коническими шестернями

полуоси — Полностью разгруженные

Масса заднего моста с тормозами и ступицами, кг — 146

Ходовая часть Газель ГАЗ-2705

Колеса — Дисковые с неразборным ободом 51/2х16Н2

Шины — Пневматические, радиальные, размером 175 R16 или 185/75 R16 С

Подвески Газель ГАЗ-2705 — Две продольные листовые рессоры

Амортизаторы — Гидравлические, телескопические двухстороннего действия. Установлены по два в передней и задней подвесках

Рулевое управление Газель ГАЗ-2705 — Винт — шариковая гайка

Рулевая колонка — С регулируемыми наклоном и высотой

Передаточное число — 23,09 (в средней части)

Тормозная система — Гидропривод рабочей тормозной системы

Двухконтурная с гидравлическим приводом и вакуумным усилителем

Тормозные механизмы Газель ГАЗ-2705

передних колес — Дисковые

задних колес — Барабанные

Запасная тормозная система — Каждый контур рабочей тормозной системы

Стояночная тормозная система — С механическим тросовым приводом к тормозным механизмам задних колес

Электрооборудование Газель ГАЗ-2705

Тип — Постоянного тока, однопроводное. Отрицательные выводы источников питания и потребителей соединены с корпусом

Номинальное напряжение, В — 12

Генератор — 16.3701 или 191.3771

Регулятор напряжения — 13.3702-04 или 50.3702

Стартер — 422.3708000 или 4216.3708.000-01

Катушка зажигания — Б 116-02 или 3122.3705

Свечи зажигания — А 14 ВР

Датчик-распределитель зажигания — 19.3706

Кузов Газель ГАЗ-2705

Тип — Цельнометаллический, полукапотный, имеет пять дверей — две распашные двери кабины, боковую сдвижную и две распашные задние двери салона

Кабина автофургонов — Трехместная (ГАЗ-2705), семиместная

Основные данные для регулировок и контроля автомобилей Газель ГАЗ-2705

Зазор между коромыслами и клапанами на холодном двигателе при 15-20° С, мм — 0,35-0,45

Нормальная температура жидкости в системе охлаждения, °С — 80-90

Минимальная частота вращения коленчатого вала в режиме холостого хода — 550-650

Прогиб ремня вентилятора при нажатии с усилием 40 Н (4 кгс), мм — 7-9

Свободный ход педали сцепления, мм — 12-28

Свободный ход педали тормоза при неработающем двигателе, мм — 3-5.

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

______________________________________________________________________________

Каталоги запасных частей и сборочных деталей

Технические характеристики ГАЗ Газель (GAZ Газель) 2705 2.9 MT 2010-2015

Технические характеристики ГАЗ Газель (GAZ Газель) 2705 2.9 MT 2010-2015. На этой странице вы узнаете особенности и характеристики ГАЗ Газель: 2705 Комби микроавтобус 4-дв., дорожный просвет (клиренс) и многое другое.

Дорожный просвет170 мм
Нагрузка на заднюю ось2285 кг
Высота2200 мм
Колея передних/задних колёс1 700/1 560 мм
Объём грузового отсека6 м3
Снаряженная масса2150 кг
Погрузочная высота725 мм
Колёсная база2900 мм
Нагрузка на переднюю/заднюю ось1 215/2 285 кг
Количество мест7
Допустимая полная масса3500 кг
Длина грузового отсека1970 мм
Колея передних колёс1700 мм
Грузовой отсек (Длина x Ширина x Высота)1 970 x 1 830 x 1 540 мм
Грузоподъёмность1350 кг
Длина5475 мм
Ширина грузового отсека1830 мм
Колея задних колёс1560 мм
Нагрузка на переднюю ось1215 кг
Ширина2075 мм
Длина x Ширина x Высота5 475 x 2 075 x 2 200 мм
Высота грузового отсека1540 мм
Тип впускаРаспределенный впрыск
Наличие интеркулераНет
Обороты максимальной мощности, макс.4000 об/мин
Максимальный крутящий момент221 Н•м
Количество цилиндров4
Обороты максимального крутящего момента, макс.2500 об/мин
Количество клапанов на цилиндр2
Тип двигателяБензиновый
Обороты максимальной мощностидо 4 000 об/мин
Объём двигателя2890 см3
Диаметр цилиндра100 мм
Конфигурация двигателяРядный
Обороты максимального крутящего моментадо 2 500 об/мин
Мощность двигателя107 л.с.
Ход поршня92 мм
Количество ступеней5
Коробка передачМеханика
ПриводЗадний
Задняя подвескаЗависимая, рессорная, амортизаторы
Передние тормозаДисковые
Задние тормозаБарабанные
Передняя подвескаАмортизаторы, рессорная, зависимая
Расход топлива в городе10.5 л/100 км
Объём топливного бака64 л
Запас ходаот 610 км
Рекомендуемое топливоАи-92
Экологический стандартEuro iv
Максимальная скорость130 км/ч
Усилитель руляГидроусилитель
Диаметр разворота11 м
Количество крепёжных отверстий6
Диаметр расположения отверстий (PCD)170
Диаметр обода16
Ширина обода5,5
Количество крепёжных отверстий6
Диаметр расположения отверстий (PCD)170
Диаметр обода16
Ширина обода5,5
Ширина профиля шины175
Высота профиля шины80
Диаметр шины16
Диаметр шины16
Ширина профиля шины175
Высота профиля шины80
Коробка передачМеханика, 5 ст.
ПриводЗадний
Диаметр разворота11 м

действий — H.R.2705 — 117-й Конгресс (2021-2022): Закон о расширении экспорта природного газа | Congress.gov

Секция записи Конгресса Ежедневный дайджест Сенат дом Расширения замечаний

Замечания участников Автор: Any House Member Адамс, Альма С.[D-NC] Адерхольт, Роберт Б. [R-AL] Агилар, Пит [D-CA] Аллен, Рик В. [R-GA] Оллред, Колин З. [D-TX] Амодеи, Марк Э. [R -NV] Армстронг, Келли [R-ND] Аррингтон, Джоди К. [R-TX] Auchincloss, Jake [D-MA] Axne, Cynthia [D-IA] Бабин, Брайан [R-TX] Бэкон, Дон [R -NE] Бэрд, Джеймс Р. [R-IN] Балдерсон, Трой [R-OH] Бэнкс, Джим [R-IN] Барр, Энди [R-KY] Барраган, Нанетт Диаз [D-CA] Басс, Карен [ D-CA] Битти, Джойс [D-OH] Бенц, Клифф [R-OR] Бера, Ami [D-CA] Бергман, Джек [R-MI] Бейер, Дональд С., младший [D-VA] Байс , Стефани И. [R-OK] Биггс, Энди [R-AZ] Билиракис, Гас М.[R-FL] Бишоп, Дэн [R-NC] Бишоп, Сэнфорд Д., младший [D-GA] Блуменауэр, Эрл [D-OR] Блант Рочестер, Лиза [D-DE] Боберт, Лорен [R-CO ] Бонамичи, Сюзанна [D-OR] Бост, Майк [R-IL] Bourdeaux, Carolyn [D-GA] Bowman, Jamaal [D-NY] Бойл, Брендан Ф. [D-PA] Брэди, Кевин [R-TX ] Брукс, Мо [R-AL] Браун, Энтони Г. [D-MD] Браун, Шонтел М. [D-OH] Браунли, Джулия [D-CA] Бьюкенен, Верн [R-FL] Бак, Кен [R -CO] Бакшон, Ларри [R-IN] Бадд, Тед [R-NC] Берчетт, Тим [R-TN] Берджесс, Майкл К. [R-TX] Буш, Кори [D-MO] Бустос, Чери [D -IL] Баттерфилд, Г.К. [D-NC] Калверт, Кен [R-CA] Каммак, Кэт [R-FL] Карбахал, Салуд О. [D-CA] Карденас, Тони [D-CA] Кэри, Майк [R-OH] Карл , Джерри Л. [R-AL] Карсон, Андре [D-IN] Картер, Эрл Л. «Бадди» [R-GA] Картер, Джон Р. [R-TX] Картер, Трой [D-LA] Картрайт, Мэтт [D-PA] Кейс, Эд [D-HI] Кастен, Шон [D-IL] Кастор, Кэти [D-FL] Кастро, Хоакин [D-TX] Cawthorn, Madison [R-NC] Chabot, Steve [ R-OH] Чейни, Лиз [R-WY] Чу, Джуди [D-CA] Cicilline, Дэвид Н. [D-RI] Кларк, Кэтрин М. [D-MA] Кларк, Иветт Д. [D-NY] Кливер, Эмануэль [D-MO] Клайн, Бен [R-VA] Клауд, Майкл [R-TX] Клайберн, Джеймс Э.[D-SC] Клайд, Эндрю С. [R-GA] Коэн, Стив [D-TN] Коул, Том [R-OK] Комер, Джеймс [R-KY] Коннолли, Джеральд Э. [D-VA] Купер , Джим [D-TN] Корреа, Дж. Луис [D-CA] Коста, Джим [D-CA] Кортни, Джо [D-CT] Крейг, Энджи [D-MN] Кроуфорд, Эрик А. «Рик» [ R-AR] Креншоу, Дэн [R-TX] Крист, Чарли [D-FL] Кроу, Джейсон [D-CO] Куэльяр, Генри [D-TX] Кертис, Джон Р. [R-UT] Дэвидс, Шарис [ D-KS] Дэвидсон, Уоррен [R-OH] Дэвис, Дэнни К. [D-IL] Дэвис, Родни [R-IL] Дин, Мадлен [D-PA] ДеФацио, Питер А. [D-OR] DeGette, Диана [D-CO] ДеЛауро, Роза Л.[D-CT] ДельБене, Сьюзан К. [D-WA] Дельгадо, Антонио [D-NY] Демингс, Вал Батлер [D-FL] ДеСолнье, Марк [D-CA] ДеДжарле, Скотт [R-TN] Дойч, Теодор Э. [D-FL] Диас-Баларт, Марио [R-FL] Дингелл, Дебби [D-MI] Доггетт, Ллойд [D-TX] Дональдс, Байрон [R-FL] Дойл, Майкл Ф. [D- PA] Дункан, Джефф [R-SC] Данн, Нил П. [R-FL] Эллзи, Джейк [R-TX] Эммер, Том [R-MN] Эскобар, Вероника [D-TX] Эшу, Анна Г. [ D-CA] Эспайлат, Адриано [D-NY] Эстес, Рон [R-KS] Эванс, Дуайт [D-PA] Фэллон, Пэт [R-TX] Feenstra, Рэнди [R-IA] Фергюсон, А. Дрю, IV [R-GA] Фишбах, Мишель [R-MN] Фицджеральд, Скотт [R-WI] Фитцпатрик, Брайан К.[R-PA] Флейшманн, Чарльз Дж. «Чак» [R-TN] Флетчер, Лиззи [D-TX] Фортенберри, Джефф [R-NE] Фостер, Билл [D-IL] Фокс, Вирджиния [R-NC] Франкель, Лоис [D-FL] Франклин, К. Скотт [R-FL] Фадж, Марсия Л. [D-OH] Фулчер, Расс [R-ID] Гаец, Мэтт [R-FL] Галлахер, Майк [R- WI] Гальего, Рубен [D-AZ] Гараменди, Джон [D-CA] Гарбарино, Эндрю Р. [R-NY] Гарсия, Хесус Дж. «Чуй» [D-IL] Гарсия, Майк [R-CA] Гарсия , Сильвия Р. [D-TX] Гиббс, Боб [R-OH] Гименес, Карлос А. [R-FL] Гомерт, Луи [R-TX] Голден, Джаред Ф. [D-ME] Гомес, Джимми [D -CA] Гонсалес, Тони [R-TX] Гонсалес, Энтони [R-OH] Гонсалес, Висенте [D-TX] Гонсалес-Колон, Дженниффер [R-PR] Гуд, Боб [R-VA] Гуден, Лэнс [R -TX] Госар, Пол А.[R-AZ] Gottheimer, Джош [D-NJ] Granger, Kay [R-TX] Graves, Garret [R-LA] Graves, Sam [R-MO] Green, Al [D-TX] Green, Mark E. [R-TN] Грин, Марджори Тейлор [R-GA] Гриффит, Х. Морган [R-VA] Гриджалва, Рауль М. [D-AZ] Гротман, Гленн [R-WI] Гость, Майкл [R-MS] Гатри, Бретт [R-KY] Хааланд, Дебра А. [D-NM] Хагедорн, Джим [R-MN] Хардер, Джош [D-CA] Харрис, Энди [R-MD] Харшбаргер, Диана [R-TN] Хартцлер, Вики [R-MO] Гастингс, Элси Л. [D-FL] Хейс, Джахана [D-CT] Херн, Кевин [R-OK] Херрелл, Иветт [R-NM] Эррера Бейтлер, Хайме [R-WA ] Хайс, Джоди Б.[R-GA] Хиггинс, Брайан [D-NY] Хиггинс, Клэй [R-LA] Хилл, Дж. Френч [R-AR] Хаймс, Джеймс А. [D-CT] Хинсон, Эшли [R-IA] Холлингсворт , Трей [R-IN] Хорсфорд, Стивен [D-NV] Houlahan, Крисси [D-PA] Хойер, Стени Х. [D-MD] Hudson, Ричард [R-NC] Хаффман, Джаред [D-CA] Huizenga , Билл [R-MI] Исса, Даррелл Э. [R-CA] Джексон Ли, Шейла [D-TX] Джексон, Ронни [R-TX] Джейкобс, Крис [R-NY] Джейкобс, Сара [D-CA] Джаяпал, Прамила [D-WA] Джеффрис, Хаким С. [D-NY] Джонсон, Билл [R-OH] Джонсон, Дасти [R-SD] Джонсон, Эдди Бернис [D-TX] Джонсон, Генри К.«Хэнк» младший [D-GA] Джонсон, Майк [R-LA] Джонс, Mondaire [D-NY] Джордан, Джим [R-OH] Джойс, Дэвид П. [R-OH] Джойс, Джон [R -PA] Кахеле, Кайали [D-HI] Каптур, Марси [D-OH] Катко, Джон [R-NY] Китинг, Уильям Р. [D-MA] Келлер, Фред [R-PA] Келли, Майк [R-PA] Келли, Робин Л. [D-IL] Келли, Трент [R-MS] Ханна, Ро [D-CA] Килди, Дэниел Т. [D-MI] Килмер, Дерек [D-WA] Ким , Энди [D-NJ] Ким, Янг [R-CA] Kind, Рон [D-WI] Кинзингер, Адам [R-IL] Киркпатрик, Энн [D-AZ] Кришнамурти, Раджа [D-IL] Кустер, Энн М. [D-NH] Кустофф, Дэвид [R-TN] Лахуд, Дарин [R-IL] Ламальфа, Дуг [R-CA] Лэмб, Конор [D-PA] Ламборн, Дуг [R-CO] Ланжевен, Джеймс Р.[D-RI] Ларсен, Рик [D-WA] Ларсон, Джон Б. [D-CT] Латта, Роберт Э. [R-OH] Латернер, Джейк [R-KS] Лоуренс, Бренда Л. [D-MI ] Лоусон, Эл, младший [D-FL] Ли, Барбара [D-CA] Ли, Сьюзи [D-NV] Леже Фернандес, Тереза ​​[D-NM] Леско, Дебби [R-AZ] Летлоу, Джулия [R -LA] Левин, Энди [D-MI] Левин, Майк [D-CA] Лиу, Тед [D-CA] Лофгрен, Зои [D-CA] Лонг, Билли [R-MO] Лоудермилк, Барри [R-GA ] Ловенталь, Алан С. [D-CA] Лукас, Фрэнк Д. [R-OK] Люткемейер, Блейн [R-MO] Лурия, Элейн Г. [D-VA] Линч, Стивен Ф. [D-MA] Мейс , Нэнси [R-SC] Малиновски, Том [D-NJ] Маллиотакис, Николь [R-NY] Мэлони, Кэролайн Б.[D-NY] Мэлони, Шон Патрик [D-NY] Манн, Трейси [R-KS] Мэннинг, Кэти Э. [D-NC] Мэсси, Томас [R-KY] Маст, Брайан Дж. [R-FL] Мацуи, Дорис О. [D-CA] МакБэт, Люси [D-GA] Маккарти, Кевин [R-CA] МакКол, Майкл Т. [R-TX] Макклейн, Лиза К. [R-MI] МакКлинток, Том [ R-CA] МакКоллум, Бетти [D-MN] Макичин, А. Дональд [D-VA] Макговерн, Джеймс П. [D-MA] МакГенри, Патрик Т. [R-NC] МакКинли, Дэвид Б. [R- WV] МакМоррис Роджерс, Кэти [R-WA] Макнерни, Джерри [D-CA] Микс, Грегори W. [D-NY] Meijer, Питер [R-MI] Менг, Грейс [D-NY] Meuser, Daniel [R -PA] Mfume, Kweisi [D-MD] Миллер, Кэрол Д.[R-WV] Миллер, Мэри Э. [R-IL] Миллер-Микс, Марианнетт [R-IA] Мооленаар, Джон Р. [R-MI] Муни, Александр X. [R-WV] Мур, Барри [R -AL] Мур, Блейк Д. [R-UT] Мур, Гвен [D-WI] Морелл, Джозеф Д. [D-NY] Моултон, Сет [D-MA] Мрван, Фрэнк Дж. [D-IN] Маллин , Маркуэйн [R-OK] Мерфи, Грегори [R-NC] Мерфи, Стефани Н. [D-FL] Надлер, Джерролд [D-NY] Наполитано, Грейс Ф. [D-CA] Нил, Ричард Э. [D -MA] Негусе, Джо [D-CO] Нелс, Трой Э. [R-TX] Ньюхаус, Дэн [R-WA] Ньюман, Мари [D-IL] Норкросс, Дональд [D-NJ] Норман, Ральф [R -SC] Нортон, Элеонора Холмс [D-DC] Нуньес, Девин [R-CA] О’Халлеран, Том [D-AZ] Обернолти, Джей [R-CA] Окасио-Кортес, Александрия [D-NY] Омар, Ильхан [D-MN] Оуэнс, Берджесс [R-UT] Палаццо, Стивен М.[R-MS] Паллоне, Фрэнк, младший [D-NJ] Палмер, Гэри Дж. [R-AL] Панетта, Джимми [D-CA] Папас, Крис [D-NH] Паскрелл, Билл, мл. [D -NJ] Пейн, Дональд М., младший [D-NJ] Пелоси, Нэнси [D-CA] Пенс, Грег [R-IN] Перлмуттер, Эд [D-CO] Перри, Скотт [R-PA] Петерс, Скотт Х. [D-CA] Пфлюгер, Август [R-TX] Филлипс, Дин [D-MN] Пингри, Челли [D-ME] Пласкетт, Стейси Э. [D-VI] Покан, Марк [D-WI] Портер, Кэти [D-CA] Поузи, Билл [R-FL] Прессли, Аянна [D-MA] Прайс, Дэвид Э. [D-NC] Куигли, Майк [D-IL] Радваген, Аумуа Амата Коулман [R- AS] Раскин, Джейми [D-MD] Рид, Том [R-NY] Решенталер, Гай [R-PA] Райс, Кэтлин М.[D-NY] Райс, Том [R-SC] Ричмонд, Седрик Л. [D-LA] Роджерс, Гарольд [R-KY] Роджерс, Майк Д. [R-AL] Роуз, Джон В. [R-TN ] Розендейл старший, Мэтью М. [R-MT] Росс, Дебора К. [D-NC] Роузер, Дэвид [R-NC] Рой, Чип [R-TX] Ройбал-Аллард, Люсиль [D-CA] Руис , Рауль [D-CA] Рупперсбергер, Калифорния Датч [D-MD] Раш, Бобби Л. [D-IL] Резерфорд, Джон Х. [R-FL] Райан, Тим [D-OH] Саблан, Грегорио Килили Камачо [ D-MP] Салазар, Мария Эльвира [R-FL] Сан-Николас, Майкл FQ [D-GU] Санчес, Линда Т. [D-CA] Сарбейнс, Джон П. [D-MD] Скализ, Стив [R-LA ] Скэнлон, Мэри Гей [D-PA] Шаковски, Дженис Д.[D-IL] Шифф, Адам Б. [D-CA] Шнайдер, Брэдли Скотт [D-IL] Шрейдер, Курт [D-OR] Шрайер, Ким [D-WA] Швейкерт, Дэвид [R-AZ] Скотт, Остин [R-GA] Скотт, Дэвид [D-GA] Скотт, Роберт С. «Бобби» [D-VA] Сешнс, Пит [R-TX] Сьюэлл, Терри А. [D-AL] Шерман, Брэд [D -CA] Шерилл, Мики [D-NJ] Симпсон, Майкл К. [R-ID] Sires, Альбио [D-NJ] Slotkin, Элисса [D-MI] Смит, Адам [D-WA] Смит, Адриан [R -NE] Смит, Кристофер Х. [R-NJ] Смит, Джейсон [R-MO] Смакер, Ллойд [R-PA] Сото, Даррен [D-FL] Спанбергер, Эбигейл Дэвис [D-VA] Спарц, Виктория [ R-IN] Спейер, Джеки [D-CA] Стэнсбери, Мелани Энн [D-NM] Стэнтон, Грег [D-AZ] Stauber, Пит [R-MN] Стил, Мишель [R-CA] Стефаник, Элиза М.[R-NY] Стейл, Брайан [R-WI] Steube, В. Грегори [R-FL] Стивенс, Хейли М. [D-MI] Стюарт, Крис [R-UT] Стиверс, Стив [R-OH] Стрикленд , Мэрилин [D-WA] Суоззи, Томас Р. [D-NY] Swalwell, Эрик [D-CA] Такано, Марк [D-CA] Тейлор, Ван [R-TX] Тенни, Клаудия [R-NY] Томпсон , Бенни Г. [D-MS] Томпсон, Гленн [R-PA] Томпсон, Майк [D-CA] Тиффани, Томас П. [R-WI] Тиммонс, Уильям Р. IV [R-SC] Титус, Дина [ D-NV] Тлаиб, Рашида [D-MI] Тонко, Пол [D-NY] Торрес, Норма Дж. [D-CA] Торрес, Ричи [D-NY] Трахан, Лори [D-MA] Трон, Дэвид Дж. .[D-MD] Тернер, Майкл Р. [R-OH] Андервуд, Лорен [D-IL] Аптон, Фред [R-MI] Валадао, Дэвид Г. [R-CA] Ван Дрю, Джефферсон [R-NJ] Ван Дайн, Бет [R-Техас] Варгас, Хуан [D-CA] Визи, Марк А. [D-TX] Вела, Филемон [D-TX] Веласкес, Нидия М. [D-Нью-Йорк] Вагнер, Энн [R -MO] Уолберг, Тим [R-MI] Валорски, Джеки [R-IN] Вальс, Майкл [R-FL] Вассерман Шульц, Дебби [D-FL] Уотерс, Максин [D-CA] Уотсон Коулман, Бонни [D -NJ] Вебер, Рэнди К., старший [R-TX] Вебстер, Дэниел [R-FL] Велч, Питер [D-VT] Венструп, Брэд Р. [R-OH] Вестерман, Брюс [R-AR] Векстон, Дженнифер [D-VA] Уайлд, Сьюзан [D-PA] Уильямс, Nikema [D-GA] Уильямс, Роджер [R-TX] Уилсон, Фредерика С.[D-FL] Уилсон, Джо [R-SC] Виттман, Роберт Дж. [R-VA] Womack, Стив [R-AR] Райт, Рон [R-TX] Ярмут, Джон А. [D-KY] Янг , Дон [R-AK] Зельдин, Ли М. [R-NY] Любой член Сената Болдуин, Тэмми [D-WI] Баррассо, Джон [R-AK] Беннет, Майкл Ф. [D-CO] Блэкберн, Марша [ R-TN] Блюменталь, Ричард [D-CT] Блант, Рой [R-MO] Букер, Кори А. [D-NJ] Бузман, Джон [R-AR] Браун, Майк [R-IN] Браун, Шеррод [ D-OH] Берр, Ричард [R-NC] Кантуэлл, Мария [D-WA] Капито, Шелли Мур [R-WV] Кардин, Бенджамин Л. [D-MD] Карпер, Томас Р. [D-DE] Кейси , Роберт П., Младший [D-PA] Кэссиди, Билл [R-LA] Коллинз, Сьюзан М. [R-ME] Кунс, Кристофер А. [D-DE] Корнин, Джон [R-TX] Кортез Масто, Кэтрин [D -NV] Коттон, Том [R-AR] Крамер, Кевин [R-ND] Крапо, Майк [R-ID] Круз, Тед [R-TX] Дейнс, Стив [R-MT] Дакворт, Тэмми [D-IL ] Дурбин, Ричард Дж. [D-IL] Эрнст, Джони [R-IA] Файнштейн, Dianne [D-CA] Фишер, Деб [R-NE] Гиллибранд, Кирстен Э. [D-NY] Грэм, Линдси [R -SC] Грассли, Чак [R-IA] Хагерти, Билл [R-TN] Харрис, Камала Д. [D-CA] Хассан, Маргарет Вуд [D-NH] Хоули, Джош [R-MO] Генрих, Мартин [ D-NM] Гикенлупер, Джон В.[D-CO] Хироно, Мази К. [D-HI] Хувен, Джон [R-ND] Хайд-Смит, Синди [R-MS] Инхоф, Джеймс М. [R-OK] Джонсон, Рон [R-WI ] Кейн, Тим [D-VA] Келли, Марк [D-AZ] Кеннеди, Джон [R-LA] Кинг, Ангус С., младший [I-ME] Klobuchar, Amy [D-MN] Ланкфорд, Джеймс [ R-OK] Лихи, Патрик Дж. [D-VT] Ли, Майк [R-UT] Леффлер, Келли [R-GA] Лухан, Бен Рэй [D-NM] Ламмис, Синтия М. [R-WY] Манчин , Джо, III [D-WV] Марки, Эдвард Дж. [D-MA] Маршалл, Роджер [R-KS] МакКоннелл, Митч [R-KY] Менендес, Роберт [D-NJ] Меркли, Джефф [D-OR ] Моран, Джерри [R-KS] Мурковски, Лиза [R-AK] Мерфи, Кристофер [D-CT] Мюррей, Пэтти [D-WA] Оссофф, Джон [D-GA] Падилла, Алекс [D-CA] Пол , Рэнд [R-KY] Питерс, Гэри К.[D-MI] Портман, Роб [R-OH] Рид, Джек [D-RI] Риш, Джеймс Э. [R-ID] Ромни, Митт [R-UT] Розен, Джеки [D-NV] Раундс, Майк [R-SD] Рубио, Марко [R-FL] Сандерс, Бернард [I-VT] Сасс, Бен [R-NE] Schatz, Брайан [D-HI] Шумер, Чарльз Э. [D-NY] Скотт, Рик [R-FL] Скотт, Тим [R-SC] Шахин, Джин [D-NH] Шелби, Ричард К. [R-AL] Синема, Кирстен [D-AZ] Смит, Тина [D-MN] Стабеноу, Дебби [D-MI] Салливан, Дэн [R-AK] Тестер, Джон [D-MT] Тьюн, Джон [R-SD] Тиллис, Томас [R-NC] Туми, Патрик [R-PA] Тубервиль, Томми [R -AL] Ван Холлен, Крис [D-MD] Уорнер, Марк Р.[D-VA] Варнок, Рафаэль Г. [D-GA] Уоррен, Элизабет [D-MA] Уайтхаус, Шелдон [D-RI] Уикер, Роджер Ф. [R-MS] Уайден, Рон [D-OR] Янг , Тодд [R-IN]

Исследования жилищных программ ‹Консультативный совет по энергоэффективности магистратуры

Итоговый отчет по оценке инициативы по предварительному утеплению жилищных энергетических услуг за 2012 год

В этом отчете резюмируется оценка Инициативы (инициативы) по предварительному утеплению жилищных энергетических услуг (HES) 2012 года, предложенной администраторами электрических и газовых программ (PA) Массачусетса.Группа оценки провела оценку эффективности, предоставив клиентам дополнительный стимул для снижения их финансового бремени при проведении обычных ремонтов перед утеплением, которые требуются перед установкой определенных мер HES, а также при оценке реализации самой инициативы. Команда провела интервью с руководителями программ HES PA и ведущими поставщиками, проанализировала данные об участии в инициативе до июля 2012 года и опросила участников и клиентов, не участвующих в программе. Они также отслеживали запросы PA, проводили опросы с участниками и не участниками из всех PA, а также завершили дополнительный анализ как полных данных инициативы, так и исторических данных HES в конце сентября 2012 года и в марте 2013 года.

Эксперты сделали несколько выводов на основании результатов оценки. Результаты оценки не показали значительного изменения в скорости принятия меры для клиентов National Grid и NSTAR, которые столкнулись с препятствиями при подключении ручки и трубки. В то время как вариант «под ключ» предлагает клиентам легкий доступ к утвержденным подрядчикам, PA и ведущие поставщики, предлагавшие вариант «под ключ», были не уверены в долгосрочной жизнеспособности варианта поставки. Неучастники указали, что не понимают, что на самом деле охватывала инициатива в отношении проводки ручки и трубки.Заинтересованные стороны и клиенты, которые были подвергнуты 30-дневному требованию, указали, что дополнительное время могло бы помочь. Однако анализ показателей приема показал, что клиенты, которым был дан 30-дневный срок, имели более высокие показатели принятия, чем те, которым предлагался 90-дневный срок. Кроме того, два из трех 30-дневных PA (NSTAR и National Grid) предлагали дополнительные каналы доставки (HPC и «под ключ»), которые были недоступны для некоторых клиентов, подпадающих под 90-дневный график. Интервью с PA и ведущими поставщиками показывают, что элементы дизайна и реализации инициативы в разных PA различались.Оценка также дает рекомендации по улучшению инициативы.

Программа освещения Energy Star на раннем этапе воздействия EISA

В этом отчете обобщены результаты четырех различных исследований, направленных, в частности, на определение текущего и вероятного воздействия EISA на рынок домашнего освещения в Массачусетсе. Исследования проводились с декабря 2011 года по апрель 2013 года и были завершены для консультантов Консультативного совета по энергоэффективности и администраторов программы Массачусетса (PA).

В этом отчете представлены основные выводы и рекомендации, касающиеся осведомленности потребителей и магазинов об EISA, изменений в наличии ламп, изменений в покупках и использовании ламп, накоплении ламп накаливания, понимании потребителями основных концепций освещения и постепенном отказе от ламп накаливания мощностью 60 Вт. Некоторые ключевые выводы резюмируются ниже. Большинство потребителей оставалось в неведении о повышении стандартов эффективности освещения в результате EISA и последующего отказа от большинства ламп накаливания общего назначения.Магазины, участвующие в программе, имеют на 23% больше упаковок КЛЛ и на 4% больше упаковок светодиодов, чем магазины, которые ранее участвовали. Половина потребителей, покупающих 100-ваттные лампы накаливания, все еще могла найти их в течение последних трех месяцев 2012 года. В домохозяйствах в Массачусетсе не наблюдалось существенных изменений в использовании лампочек в период с начала 2012 года по начало 2013 года. На вопрос, какой тип лампы они предпочли бы заменить 100-ваттные лампы накаливания, большинство потребителей выбрало лампу накаливания меньшей мощности, а затем КЛЛ.В ходе исследования было обнаружено мало свидетельств широко распространенного накопления ламп накаливания по инициативе EISA. Лампы накаливания мощностью 60 Вт заполняют 22% всех розеток в домах Массачусетса, что делает их наиболее популярными в домашних условиях. Более подробные результаты каждого отдельного оценочного исследования представлены в отчете.

Инвентаризация местного освещения — окончательный отчет о результатах

В этом отчете представлены результаты инвентаризации освещения, проведенной для понимания использования, насыщенности и покупок осветительной продукции в домохозяйствах Массачусетса в поддержку Программы освещения ENERGY STAR® Массачусетса (Программа).Исследование также стремилось понять условия во время реализации Закона об энергетической независимости и безопасности (EISA) 2007 года и найти возможное влияние на использование освещения и покупательское поведение, которое может быть результатом новых стандартов освещения. Для проведения этого исследования группа провела 150 инвентаризаций освещения в домашних хозяйствах Массачусетса в период с декабря 2012 года по март 2013 года. Респонденты на месте были отобраны путем предварительного телефонного опроса среди 600 домашних хозяйств в Массачусетсе, который также проводился зимой 2012 года и в начале 2013 года.

В этом отчете представлены основные выводы и рекомендации, касающиеся использования и хранения КЛЛ, насыщения разъемов, потенциала насыщения для КЛЛ и светодиодов; хранение лампочек; Закупка КЛЛ и светодиодов; отслеживание КЛЛ с течением времени; дополнительные факторы, влияющие на использование, насыщение и покупку CLF; и Федеральные стандарты освещения. Некоторые основные выводы описаны ниже. В полном отчете эти и другие результаты представлены более подробно. Основываясь на анализе на месте, команда пришла к выводу, что большинство домашних хозяйств в Массачусетсе используют компактные люминесцентные лампы.Несмотря на высокие темпы проникновения, количество используемых КЛЛ и процент розеток, в которые они установлены, похоже, выровнялись за последние три года, и есть свидетельства того, что недавно приобретенные КЛЛ в основном используются для замены установленных КЛЛ, которые имеют сгореть. В период с 2009 по 2010 год статистически значимые успехи были достигнуты в увеличении количества специализированных КЛЛ в домах, но это увеличение не повторилось в период с 2010 по 2013 год. Светодиоды остаются новой технологией в Массачусетсе, и очень немногие дома используют какие-либо светодиодные лампы.При рассмотрении наиболее энергоэффективных типов ламп — КЛЛ, светодиодов и люминесцентных ламп — насыщение в настоящее время составляет около 40%. Использование ламп накаливания уменьшилось, но эта тенденция началась задолго до реализации первого этапа EISA. Свидетельства складирования раскаленных предметов были неоднозначными и неубедительными.

Розничный продавец осветительных приборов, Перспективы поставщиков в отношении окончательного отчета по программе освещения Energy Star в штате Массачусетс

В этом проекте отчета представлены результаты собеседований с розничными торговцами и поставщиками, проведенных в поддержку оценки программы освещения ENERGY STAR® в Массачусетсе на 2011–2012 годы.

В этом отчете представлены основные выводы и рекомендации, касающиеся влияния EISA, рынка светодиодных ламп, программной деятельности на труднодоступных рынках освещения, степени удовлетворенности программой и авторства программы. Некоторые основные выводы описаны ниже. В полном отчете эти и другие результаты представлены более подробно. Осведомленность менеджеров магазинов о законодательстве EISA с 2010 года значительно возросла. Пятьдесят пять процентов менеджеров магазинов, осведомленных EISA, которые заявили, что законодательство EISA повлияло на их практику складирования, заявили, что их запасы ламп накаливания уменьшились.Две трети менеджеров магазинов, которые изменили свои методы складирования в ответ на EISA, заявили, что у них увеличился запас стандартных КЛЛ. Незначительное большинство менеджеров магазинов, сообщивших о воздействиях, связанных с EISA, заявили, что их продажи и запасы светодиодных ламп увеличились. Производители освещения разошлись во мнениях относительно того, насколько хорошо продаются галогенные лампы, соответствующие требованиям EISA. Согласно данным отслеживания программы, только 41 из 240 участвующих магазинов в нашей выборке (17%) продавал светодиодную продукцию через программу.Было много причин, по которым менеджеры магазинов не продавали светодиоды, наиболее часто упоминаемая причина заключалась в том, что лампы были слишком дорогими. Рекомендации розничных продавцов по расширению доступа к программам в секторах HTR включают в себя более активный маркетинг и снижение цен. Семьдесят один процент опрошенных менеджеров магазинов остались довольны программой в целом.

Окончательный отчет по обследованию полок для освещения жилых помещений и анализу цен

В этом отчете описывается исследование по оценке влияния программы освещения жилых помещений Mass Save® на цены на КЛЛ в штате по сравнению с конкурирующими осветительными приборами, размер полки, выделенной для КЛЛ для участвующих розничных продавцов, цены, количество упаковок ламп. ; и расположение на полках КЛЛ и светодиодов относительно других типов освещения в участвующих и бывших участвующих магазинах.Результаты текущего опроса сравнивались с результатами аналогичного опроса, проведенного в 2010 году. Для выполнения этого анализа группа оценки разработала и проанализировала опрос о складских запасах и регрессионный анализ гедонистического ценообразования.

После учета различий в мощности, канале продаж, производителе и других характеристиках стандартных CFL со скидкой и без скидки, влияние скидки PA привело к снижению регистровой цены CFL с программной скидкой в ​​среднем на 1 доллар.76. Точечная оценка в 1,76 доллара США составляет 86% от суммы поощрения PA. Для сравнения, в 2010 году средний эффект составил 1,46 доллара США, что составило 117% от суммы поощрительного вознаграждения в этом году. Таким образом, в 2012 году выяснилось, что партнеры не передают потребителям полный стимул PA. Стимул PA был связан со снижением цен на лампочки A-образные, рефлекторные и глобальные КЛЛ в диапазоне от 0,96 до 2,15 доллара. Это снижение цены было меньше, чем то, что наблюдалось в 2010 году, когда снижение цены составляло от 2 долларов.33 до 3,61 доллара. Магазины, продающие КЛЛ со скидкой ПА, как правило, имеют более высокий процент упаковок КЛЛ, чем бывшие участвующие магазины. В участвующих магазинах процент полочного пространства, выделенного для КЛЛ, увеличился по большинству каналов сбыта с 2010 по 2012 год.

2012 Оценка бытового оборудования для отопления, водонагревания и охлаждения, чистая и валовая, влияние на рынок и сроки замены оборудования

В этом отчете приводятся итоговые значения чистой и валовой стоимости (NTG), сроки замены оборудования (ER) и чистый рыночный эффект (NME) для программ Cool Smart и высокоэффективного отопительного и водонагревательного оборудования (HEHE) для Период 2010-2012 гг.Группа основывала выводы, заключения и рекомендации оценки на результатах ряда мероприятий по сбору данных и задач оценки и сообщала о результатах NTG, ER и NME на уровне меры.

Мерами, обеспечивающими большую часть экономии за счет установки оборудования в программах HEHE и Cool Smart, являются центральные системы HVAC: газовые котлы, газовые печи, CAC и тепловые насосы. По оценкам подрядчиков и участников IV квартала, значительная часть участников заменяет оборудование раньше срока.Значительная часть клиентов, заменяющих котлы и печи на раннем этапе, также переключается с нефти на газ. Последствия этих выводов для политики более подробно рассматриваются в отчете. Был разработан ряд оценок NTG. Все средние оценки NTG составляют приблизительно 0,75 или больше, за исключением мини-разломов без протока (0,62). В целом, эти оценки NTG подтверждаются анализом NME дистрибьютора.

Окончательный отчет о дополнительных затратах по программе нового строительства жилых домов

В этом отчете представлены оценки дополнительных затрат на квадратный фут, задействованных в строительстве высокоэффективных домов, соответствующих критериям Программы нового жилищного строительства (RNC) штата Массачусетс 2013 года.Дополнительные затраты, превышающие затраты на строительство типичных домов вне программы, оцениваются для односемейных (SF), малоэтажных многоквартирных домов в три или менее этажей (MF 1-3) и для многоквартирных домов средней и высотной этажности из четырех. рассказы или более (MF 4+) для каждого из вариантов поощрения, предлагаемых программой. Программа MA RNC 2013 предлагает пять вариантов стимулирования для строительных секторов SF и MF 1-3 — два на основе предписывающих мер и три варианта производительности на основе процентной экономии — и три варианта стимулирования для строительного сектора MF 4+.

Предполагаемые дополнительные затраты варьируются в зависимости от вариантов стимулирования, особенно для домов в секторе пристроенных зданий SF. Разница обусловлена ​​как видами мер, которые были реализованы для удовлетворения требований опциона, так и степенью усиления этих мер. Дополнительные затраты на квадратный фут для односемейных пристроенных домов варьируются от 1,03 до 5,61 доллара; многоквартирные дома без главного счетчика колеблются от 0,10 до 1,50 доллара; Многоквартирный дом с главным счетчиком газа колеблется от 0,08 доллара до 1 доллара.48; и MF 103 в целом варьировались от 0,60 до 3,10 доллара.

Итоговый отчет по результатам опроса потребителей, зима 2012

В исследовании, представленном в этом отчете, сравниваются результаты телефонного опроса, проведенного с 4 декабря 2012 г. по 21 января 2013 г., с результатами двух аналогичных опросов, проведенных с 8 декабря 2011 г. по 19 января 2012 г. и 18 июня. 2012 г. и 2 августа 2012 г. соответственно. Исследование зимы 2011 года стремилось установить исходную точку начала изменений в стандартах освещения, вытекающих из Закона об энергетической независимости и безопасности 2007 года (EISA), в то время как исследования середины и зимы 2012 года были направлены на поиск возможных изменений на рынке освещения с момента его появления. внедрение EISA.По возможности, Группа также сравнивает результаты с результатами, полученными в результате обследований освещения, проведенных в 2009 и 2010 годах.

Зимний опрос 2012 года свидетельствует о том, что удовлетворенность клиентов компактными люминесцентными лампами остается стабильной. Постоянная озабоченность по поводу КЛЛ зимой 2012 года связана с содержанием в них ртути и проблемами утилизации. Результаты зимнего опроса 2012 года показывают, что использование, знания и мнения о КЛЛ различались между теми, кто использовал много КЛЛ (эксперты), и теми, кто использовал несколько лампочек или совсем не использовал их (новички).Подгруппа респондентов зимнего 2012 года объяснила, что они хотели бы отдать предпочтение светодиодам в качестве источника освещения, но не решались тратить 20 долларов на лампочку. Когда 75-ваттная лампа накаливания больше не доступна, увеличилось количество потребителей, которые указали, что планируют перейти на более мощную лампу накаливания. Респонденты всех трех волн опроса сообщили об относительно низком уровне знакомства с КЛЛ A-line, хотя зимой 2012 года наблюдалось небольшое увеличение знакомства с лампочкой. Результаты, представленные за зиму 2012 года, показывают, что пятая часть респондентов рассматривает возможность складирования ламп накаливания в связи с отказом от 75-ваттной мощности.Потребители все больше знакомы с термином «люмен» и понимают, что он означает световой поток или яркость, но они по-прежнему покупают лампы на основе мощности или эквивалентной мощности. В полном отчете эти и другие результаты представлены более подробно.

Кратковременное введение оксандролона стимулирует синтез чистого мышечного белка у молодых мужчин1 | Журнал клинической эндокринологии и метаболизма

Кратковременный прием тестостерона стимулирует чистый синтез белка у здоровых мужчин.Мы исследовали, улучшит ли оксандролон [оксандрин (OX)], синтетический аналог тестостерона, чистый синтез мышечного белка и транспорт аминокислот через ногу. Шесть здоровых мужчин [22 ± 1 (± se) год] были исследованы в постабсорбционном состоянии до и после 5 дней перорального приема ОХ (15 мг / день). Синтез и распад мышечного белка определяли с помощью трехкомпонентной модели с использованием стабильных изотопных данных, полученных при отборе проб бедренной артерио-венозной крови и биопсии мышц. Для определения скоростей фракционного синтеза мышечного белка использовали метод «предшественник-продукт».Непосредственно рассчитывались также коэффициенты дробной разбивки. Концентрации общей матричной рибонуклеиновой кислоты (мРНК) инсулиноподобного фактора роста I в скелетных мышцах и рецептора андрогенов (AR) определяли с помощью ОТ-ПЦР. Синтез мышечного белка на основе модели увеличился с 53,5 ± 3 до 68,3 ± 5 (среднее ± стандартное отклонение) нмоль / мин · 100 мл / ногу ( P <0,05), тогда как распад белка не изменился. Входящий транспорт аминокислот оставался неизменным с OX, тогда как исходящий транспорт снижался ( P <0.05). Скорость фракционного синтеза увеличилась на 44% ( P <0,05) после введения ОХ без изменения скорости фракционного распада. Таким образом, чистый баланс между синтезом и разрушением стал более положительным при использовании обеих методик ( P <0,05) и не отличался от нуля. Кроме того, RT-PCR показала, что введение OX значительно увеличивало концентрации мРНК AR скелетных мышц без изменения концентраций мРНК инсулиноподобного фактора роста I. Мы пришли к выводу, что кратковременное введение ОХ стимулировало увеличение синтеза белка скелетных мышц и улучшало внутриклеточное повторное использование аминокислот.Механизм этой стимуляции может быть связан с индуцированным OX увеличением экспрессии AR в скелетных мышцах.

СПОРТСМЕНОВ уже давно используют анаболические агенты для улучшения мышечной массы и силы. Однако клиницисты только недавно осознали преимущества анаболических агентов для пациентов с мышечным истощением, связанным с травмами или заболеваниями. Недавно несколько клинических исследований продемонстрировали положительные преимущества введения тестостерона (Т) для различных групп пациентов. В частности, мужчинам с гипогонадизмом полезна заместительная терапия тестостероном за счет увеличения массы скелетных мышц (1–3), увеличения плотности костей (2) и увеличения синтеза белка (1).Аналогичным образом, у пожилых мужчин, получающих заместительную терапию Т, наблюдается увеличение безжировой массы тела (4), силы (5) и синтеза белка (5) наряду со снижением резорбции костной ткани (4). Более того, изменения в составе тела, включая потерю безжировой массы тела, сильно коррелируют с уровнями андрогенов у гипогонадных мужчин с истощающей миопатией с синдромом приобретенного иммунодефицита (СПИД) (6).

Недавно мы показали, что энантат (ТЕ), вводимый внутримышечно здоровым молодым мужчинам, увеличивает чистый синтез белка и повторное использование внутриклеточных аминокислот в скелетных мышцах (7).Кроме того, несколько других исследований показали, что введение Т увеличивает синтез мышечного белка (1, 5, 8), хотя в этих исследованиях не удалось измерить распад белка. Одним из основных ограничений предыдущих исследований фракционной скорости синтеза (FSR) является невозможность одновременной оценки распада белка. Следовательно, традиционный подход к изучению кинетики мышечного белка (, то есть FSR) не дал информации о чистом балансе между синтезом и распадом.Поэтому наша лаборатория разработала новый метод измерения фракционного распада белка, который не зависит от артериовенозной (A-V) модели (9).

Хотя природные андрогены, такие как T, явно стимулируют синтез мышечного белка, они также обладают андрогенным или вирилизирующим действием. Часто это ограничивает использование этих андрогенов врачом для определенных групп пациентов, таких как мужчины с гипогонадизмом. Тем не менее, были предприняты усилия по поиску альтернативных анаболических агентов, которые можно было бы использовать у женщин и детей, страдающих от истощающих мышцы заболеваний или травм.Оксандролон [Oxandrin (OX) Bio-Technology General, Iselin, NJ], синтетический аналог Т, представляет собой пероральный анаболический стероид, который в настоящее время используется в качестве дополнительной терапии для увеличения веса у пациентов после хирургических операций, хронических инфекций и тяжелых травм. ОКС улучшил прибавку в весе у пациентов, страдающих миопатией из-за СПИДа (10), а также у выздоравливающих ожоговых пациентов (ожоги 30–50% общей площади тела) (11). Кроме того, OX используется клиницистами для лечения детей с нарушениями роста, такими как синдром Тернера и конституциональная задержка роста и полового созревания (12, 13).Недавнее пилотное исследование мальчиков с мышечной дистрофией Дюшенна показало, что оксид оксида азота в дозе 0,1 мг / кг · день улучшал мышечную силу в течение 3-месячного периода (14). Учитывая, что OX вводится перорально, а не внутримышечно, как и TE, простота введения делает его привлекательным как для клиницистов, так и для пациентов. Кроме того, предполагается, что OX имеет гораздо больший анаболический потенциал, чем T, с меньшим количеством андрогенных эффектов. Однако никакие исследования не показали, способствует ли OX, как и TE, стимуляция синтеза белка в скелетных мышцах.

Таким образом, мы исследовали, улучшает ли OX, предполагаемый анаболический агент, синтез чистого мышечного протеина и транспорт аминокислот у молодых мужчин натощак. Настоящее исследование было разработано для имитации 5-дневного исследования TE на нормальных мужчинах, о котором говорилось ранее (7). Мы стремились оценить краткосрочные (5-дневные) эффекты умеренной дозы (15 мг / день) OX на включение аминокислот в мышечные белки с использованием установленной кинетической модели белка (15, 16). Мы также исследовали влияние OX на концентрации рибонуклеиновой кислоты (мРНК) инсулиноподобного фактора роста I (IGF-I) и рецепторов андрогенов (AR) в скелетных мышцах.

Объекты и методы

Субъекты

Шесть здоровых мужчин [возраст, 22 ± 3 (± стандартное отклонение) года; вес 77 ± 13 кг; рост, 178 ± 7 см] изучались до и после приема суточной дозы перорального ОКС (15 мг / сут) в течение 5 дней. Все субъекты дали информированное письменное согласие в соответствии с руководящими принципами, установленными наблюдательным советом при Медицинском отделении Техасского университета (Галвестон, Техас). Приемлемость субъектов оценивалась путем проведения медицинского обследования, которое включало электрокардиограмму, анализ крови, электролиты плазмы, концентрацию глюкозы в крови, а также тесты функции печени и почек.Субъекты с заболеваниями сердца или печени, нарушениями гипо- или гиперкоагуляции, сосудистыми заболеваниями, гипертонией, диабетом или аллергией на йодиды были исключены из участия.

Протокол эксперимента

Все исследования инфузии изотопов проводились в Общем клиническом исследовательском центре Медицинского отделения Техасского университета. Субъекты были приняты за ночь перед каждым исследованием и не голодали с 22:00 до завершения 5-часового исследования инфузии изотопов.Примерно в 06:30 на следующее утро (день 0) полиэтиленовый катетер 20 размера (Insyte-W, Becton Dickinson and Co., Sandy, UT) вставляли в антекубитальную вену одной руки для инфузии аминокислот. Второй полиэтиленовый катетер 20 калибра помещали в противоположное запястье для забора крови для измерения системного индоцианинового зеленого (ICG). На руку и запястье помещали грелку для поддержания температуры около 65 ° C во время измерения кровотока.

В 07:00 в дни 0 и 5 были взяты исходные образцы крови для анализа фонового обогащения аминокислот, концентрации ICG и пиковых концентраций T и OX.Примированная непрерывная инфузия меченого фенилаланина была начата при следующей скорости инфузии (IR) и начальной дозе (PD): 1- [кольцо- 2 H 5 ] фенилаланин, IR = 0,05 мкмоль / кг · мин, PD = 2 мкмоль / кг. Примерно в 07:30 ч. Полиэтиленовый катетер Кука 3-Fr 8 см (Bloomington, IN) под местной анестезией вводили в бедренную артерию и вену. Бедренные катетеры требовались для забора крови A-V и инфузии ICG (артерии) для определения кровотока в ногах.

Биопсию латеральной широкой мышцы бедра получали через 2 часа, 4 часа 30 минут и 5 часов инфузии индикатора с использованием 5-миллиметровой иглы Бергстрема, как описано ранее (16).Ткань немедленно замораживали в жидком азоте и хранили при -80 ° C до анализа. После 2-часовой биопсии была начата примированная (2 мкмоль / кг) непрерывная инфузия 1- [ 15 N] фенилаланина, которая поддерживалась до 4 часов (рис. 1). Артериальное и внутриклеточное обогащение l- [ 15 N] фенилаланином на плато и снова после распада было получено с целью определения скорости фракционного распада (FBR). Биопсии через 4 часа 30 минут и 5 часов были использованы для определения FBR. Фракционную скорость синтеза (FSR) белка скелетных мышц определяли путем включения 1- [кольцо- 2 H 5 ] фенилаланина в белок в течение 2–5 часов.

Рисунок 1.

Протокол инфузии стабильного изотопа. кольцо- 2 H 5 -PHE, 1- [кольцо- 2 H 5 ] фенилаланин; 15 N-ПГЭ, 1- [ 15 N] фенилаланин.

Рисунок 1.

Протокол инфузии стабильного изотопа. кольцо- 2 H 5 -PHE, 1- [кольцо- 2 H 5 ] фенилаланин; 15 N-ПГЭ, 1- [ 15 N] фенилаланин.

Образцы крови A-V были получены с 20-минутными интервалами от 4 до 5 часов для определения кинетики аминокислот.За пятнадцать минут до часа отбора проб была начата непрерывная инфузия (IR = 0,5 мг / мин) ICG и позволена достичь системного равновесия (10-15 минут) для целей измерения кровотока в ногах. Последующий забор крови производился одновременно из бедренной вены и из нагретой вены запястья в течение часа забора крови. Чтобы избежать нарушения измерений кровотока, все образцы крови A-V для определения аминокислотной кинетики были получены после измерения кровотока, и ICG была остановлена. ICG был перезапущен и позволил работать непрерывно в течение приблизительно 10-15 минут перед следующим измерением кровотока.

В конце исследования 5-часовой инфузии субъектов накормили, и все периферические и бедренные катетеры были удалены. Начиная с 21:00 в день 0, все субъекты получали 15 мг OX (BTG Pharmaceuticals Co., Изелин, Нью-Джерси) перорально в течение 5 дней. На 3 день субъекты вернулись в Центр общих клинических исследований в 07:00 для взятия пробы венозной крови для определения общих концентраций T и OX. На 5-й день был повторен описанный выше экспериментальный протокол.

Аналитические методы

Кровь. Концентрации немеченого и меченого фенилаланина определяли методом газовой хроматографии-масс-спектрометрии (ГХ-МС), как описано ранее (16). Вкратце, образцы крови A-V собирали в предварительно взвешенные пробирки, содержащие 15% сульфосалициловую кислоту. Добавляли известный внутренний стандарт (100 мкл / мл крови) и тщательно перемешивали. Состав этой стандартной смеси был 50,3 мкмоль / л l- [кольцо- 13 C 6 ] фенилаланин. После повторного взвешивания пробирок для определения конечного объема крови пробирки центрифугировали, супернатант собирали и хранили при -20 ° C до анализа.Аминокислоты в крови были разделены с использованием катионообменной хроматографии (16) и обогащения внутреннего стандарта, и введенные индикаторы были определены на их производных трет -бутилдиметилсилил ( t -BDMS) (17). Используя ГХ-МС, изотопное обогащение свободных аминокислот в крови определяли с помощью положительной химической ионизации и мониторинга выбранных ионов (модель 5973, Hewlett-Packard Co., Пало-Альто, Калифорния). Наконец, кровоток в ногах определяли спектрофотометрически путем измерения сывороточной концентрации ICG при λ = 805 нм.

Мышца. Образцы мышц взвешивали, и белок осаждали 500 мкл 14% хлорной кислоты. Для измерения внутриклеточных концентраций фенилаланина добавляли раствор известного внутреннего стандарта (2 мкл / мг мышечной ткани). Раствор содержал 2,4 мкмоль / л 1- [кольцо- 13 C 6 ] фенилаланин. Супернатант собирали после гомогенизации ткани и центрифугирования. Эта процедура повторялась трижды. Объединенный супернатант с мышечными аминокислотами разделяли с помощью катионообменной хроматографии (16).Обогащение и концентрации внутриклеточных аминокислот определяли на их трет- -бутил-метилсилильных производных (17) с помощью ГХ-МС в режиме электронного удара. Внутриклеточное обогащение определяли поправкой на внеклеточную жидкость на основе хлоридного метода (18). Оставшийся осадок промывали несколько раз 0,9% физиологическим раствором и снова абсолютным этанолом, сушили при 50 ° C в течение ночи и гидролизовали в 6 н. HCl при 110 ° C в течение 24 часов. Затем гидролизат пропускали через катионообменную колонку так же, как обрабатывали кровь.Образцы анализировали на обогащение фенилаланином с помощью ГХ-МС (модель 8000, MD 800, Fisons Instruments, Манчестер, Великобритания) с использованием химической ионизации и подхода стандартной кривой (19).

Гормональные анализы. Концентрацию общего Т измеряли в сыворотке с помощью коммерческого набора для РИА (Diagnostic Products, Лос-Анджелес, Калифорния). Свободный или биодоступный T измеряли с помощью равновесного диализа [Mayo Medical Laboratories (Рочестер, Миннесота), Quest Diagnostics, Inc., Nichols Institute (Сан-Хуан-Капистрано, Калифорния)].Концентрации OX в сыворотке были измерены Олимпийской аналитической лабораторией Калифорнийского университета в Лос-Анджелесе. Вкратце, жидкостно-жидкостную экстракцию выполняли путем добавления 50 мкл внутреннего стандарта [16,16,17- 3 H] T (d 3 T; 12 мкг / мл; MSD Isotopes, Монреаль, Квебек), 1 мл 50% насыщенного буфера с ацетатом натрия (0,5 моль / л; pH 5,5) и этилового эфира (5 мл) на 0,5 мл плазмы. После встряхивания (10 мин) и центрифугирования (15 мин при 2000 об / мин) слой этилового эфира сушили в атмосфере азота при комнатной температуре и восстанавливали в 200 мкл метанола для анализа методом высокоэффективной жидкостной хроматографии.Жидкостную хроматографию выполняли на системе Shimadzu (Shimadzu, Columbia, MD), оснащенной колонкой Hypersil BDS C 18 , 50 × 2 мм (Keystone Scientific, Inc., Bellefonte, PA) и Hypersil BDS C 18 , Предколонка 20 × 2 мм, работающая при скорости потока 400 мкл / мин. Объем инъекции составлял 5 мкл. Градиент: метанол-вода (1: 1) в течение 1 мин, метанол-вода (9: 1) в течение следующей 1 мин, выдержка в течение 1 мин и возврат в исходное состояние через 0,5 мин. MS-анализы выполнялись на тройном квадруполе Perkin Elmer Corp.-Sciex API 300 (Norwalk, CT) с интерфейсом APCI. Температура небулайзера была оптимизирована для максимальной чувствительности при 350 ° C. Положительные ионы (m + 1) для OX (307,2; Searle Pharmaceutical, Чикаго, Иллинойс) и d 3 T (292,2) были введены во второй квадруполь для индуцированных столкновением. диссоциация. Ионы продукта 289,2 и 97,0 отслеживали и использовали для количественного определения OX и d 3 T соответственно. Концентрации определяли по шеститочечной калибровочной кривой.

Выделение тотальной РНК и качественная ОТ-ПЦР. Общая РНК была выделена из образцов мышечной биопсии (50–75 мг) с использованием РНКазола B (Tel-Test, Inc., Friendswood, TX). Затем два микрограмма общей РНК были преобразованы в ДНК с использованием системы обратной транскрипции (Promega Corp., Мэдисон, Висконсин). Затем ДНК (5 мкл) подвергали ПЦР в присутствии соответствующих праймеров. Продукты ПЦР обрабатывали на геле по Саузерну, а продукты амплифицированной ДНК определяли с помощью лестницы ДНК. Затем проводили саузерн-блоты и гибридизовали с олигонуклеотидами фрагмента ДНК.Глицеральдегидфосфатдегидрогеназа (GAP) была коамплифицирована в каждом образце в качестве внутреннего контроля. Для AR нижележащий праймер был включен в реакцию обратной транскриптазы. Праймеры и гибридизационные олигонуклеотиды для IGF-I и AR следующие: IGF-I: смысл, 5′-AAATCAGCAGTCTTGGAACC-3 ‘; антисмысловой, 5 ‘CTTCTGGGTCTTGGGCATGT 3′; олигонуклеотид, 5’-CAAGCCCACAG-GGTATGGCTCCAGCAGT-3 ‘; AR: смысл, 5’-GATGCTCTACTTCGCCCCTGA-3 ‘; антисмысловой, 5’-CCCAGCAAATAGAATTCCATGAC-3 ‘; олигонуклеотид, 5’-CTGGGTGTGGAAATAGATG-3 ‘; и GAP: смысл, 5’-GGTATCGTGGAAGGACTCAT-3 ‘; антисмысловой, 5’-TCCACCACCCTGT-TGCTGTA-3 ‘; олигонуклеотид, 5’-GTGGGTGTCGCTGTTGAAGT-3 ‘.

Плотность полос саузерн-блоттинга измеряли с помощью программы анализа ImageQuant (Molecular Dynamics, Inc., Саннивейл, Калифорния).

Расчеты

Кинетическая модель. Кинетика внутриклеточных свободных аминокислот была описана ранее (16). Однако мы кратко детализируем кинетические параметры, которые составляют трехпуловую модель кинетики аминокислот в ногах (рис. 2).

Рисунок 2.

Трехкомпонентная модель кинетики аминокислот в ногах.Пулы свободных аминокислот в бедренной артерии (A), бедренной вене (V) и мышце (M) соединены стрелками , , что указывает на однонаправленный поток аминокислот между каждым отсеком. Аминокислоты попадают в ногу через бедренную артерию (F в ) и уходят через бедренную вену (F из ). F V, A — это прямой поток из артерии в вену аминокислот, которые не попадают во внутриклеточную жидкость. F M, A и F V, M — это внутренний и внешний транспорт от артерии к мышце и от мышцы к вене соответственно.F M, O — вид внутриклеточной аминокислоты в результате протеолиза фенилаланина. F O, M — скорость исчезновения внутриклеточных аминокислот для синтеза белка фенилаланина.

Рисунок 2.

Трехкомпонентная модель кинетики аминокислот в ногах. Пулы свободных аминокислот в бедренной артерии (A), бедренной вене (V) и мышце (M) соединены стрелками , , что указывает на однонаправленный поток аминокислот между каждым отсеком. Аминокислоты попадают в ногу через бедренную артерию (F в ) и уходят через бедренную вену (F из ).F V, A — это прямой поток из артерии в вену аминокислот, которые не попадают во внутриклеточную жидкость. F M, A и F V, M — это внутренний и внешний транспорт от артерии к мышце и от мышцы к вене соответственно. F M, O — вид внутриклеточной аминокислоты в результате протеолиза фенилаланина. F O, M — скорость исчезновения внутриклеточных аминокислот для синтеза белка фенилаланина.

Бедренная артерия доставляет (F из ) аминокислоты в ногу, тогда как аминокислоты уходят через бедренную вену (F из ).Следовательно, эти аминокислоты могут перемещаться между отделами между артерией (A), веной (V) и мышцей (M). Внутренний транспорт аминокислот от A к M (F M, A ) и внешний транспорт аминокислот от M к V (F V, M ) происходит через бедренную артерию и вену, соответственно. Таким образом, внутренний (F в ) и внешний (F из ) транспорт ткани был рассчитан следующим образом:

| \ mathrm {F} _ {\ mathrm {in}} {=} \ mathrm {C} _ {\ mathrm {A}} {\ times} \ mathrm {BF} $ |

| \ mathrm {F} _ {\ mathrm {out}} {=} \ mathrm {C} _ {\ mathrm {V}} {\ times} \ mathrm {BF} $ |

| \ mathrm {F} _ {\ mathrm {M, A}} {=} {\ {} {[} (\ mathrm {E} _ {\ mathrm {M}} {-} \ mathrm {E} _ {\ mathrm {V}} \ mathrm {) / (E} _ {\ mathrm {A}} {-} \ mathrm {E} _ {\ mathrm {M}}) {]} {\ times} \ mathrm {C} _ {\ mathrm {V}} {+} \ mathrm {C} _ {\ mathrm {A}} {\}} {\ times} \ mathrm {BF} $ |

| \ mathrm {F} _ {\ mathrm {V, M}} {=} {\ {} {[} (\ mathrm {E} _ {\ mathrm {M}} {-} \ mathrm {E} _ {\ mathrm {V}} \ mathrm {) / (E} _ {\ mathrm {A}} {-} \ mathrm {E} _ {\ mathrm {M}}) {]} {\ times} \ mathrm {C} _ {\ mathrm {V}} {+} \ mathrm {C} _ {\ mathrm {V}} {\}} {\ times} \ mathrm {BF} $ |

, где C A и C V и E A и E V — концентрации аминокислот и обогащение индикаторов в бедренной артерии и вене, а E M — обогащение в мышцах.Кровоток в ноге представлен BF. Аминокислоты, которые обходят мышцу через бедренную артерию, можно вычислить с помощью любого из следующих выражений:

| \ mathrm {F} _ {\ mathrm {V, A}} {=} \ mathrm {F} _ {\ mathrm { in}} {-} \ mathrm {F} _ {\ mathrm {M, A}} $ |

| \ mathrm {F} _ {\ mathrm {V, A}} {=} \ mathrm {F} _ {\ mathrm {out}} {-} \ mathrm {F} _ {\ mathrm {V, M }} $ |

Модель также позволяет рассчитать скорость внутриклеточного появления (F M, O ) аминокислот в результате распада белка и скорость использования аминокислот (F O, M ) для синтеза белка.Внешний вид и использование аминокислот рассчитываются соответственно по следующим формулам:

| \ mathrm {F} _ {\ mathrm {M, O}} {=} \ mathrm {F} _ {\ mathrm {M, A}} { \ times} (\ mathrm {E} _ {\ mathrm {A}} \ mathrm {/ E} _ {\ mathrm {M}} {-} 1) $ |

| \ mathrm {F} _ {\ mathrm {O, M}} {=} (\ mathrm {C} _ {\ mathrm {A}} {\ times} \ mathrm {E} _ {\ mathrm {A }} {-} \ mathrm {C} _ {\ mathrm {V}} {\ times} \ mathrm {E} _ {\ mathrm {V}}) {\ times} \ mathrm {BF / E} _ {\ mathrm {M}} $ |

Следующее выражение представляет собой общую скорость появления (Ra M ) внутриклеточных аминокислот, которая является функцией распада белка (F M, O ) и транспорта внутрь ткани (F M, A ).

| \ mathrm {Ra} _ {\ mathrm {M}} {=} \ mathrm {F} _ {\ mathrm {M, O}} {+} \ mathrm {F} _ {\ mathrm {M, A} } $ |

Эффективность синтеза белка (PSE). Используя фенилаланин, мы рассчитали относительную эффективность синтеза белка следующим образом:

| \ mathrm {PSE} {=} \ mathrm {F} _ {\ mathrm {O, M}} \ mathrm {/ (F} _ {\ mathrm {M, A}} {+} \ mathrm {F} _ {\ mathrm {M, O}} \ mathrm {)} $ |

PSE определяется как доля скорости появления внутриклеточных аминокислот, которая включается в мышечные белки, с учетом того, что фенилаланин не окисляется в мышцах.Следовательно, F O, M представляет собой количество аминокислоты, включенной в мышечные белки. FSR. Используя традиционный метод «предшественник-продукт», мы определили FSR мышечных белков путем измерения скорости включения индикатора фенилаланина в белок и обогащения внутриклеточного пула в качестве предшественника

| \ mathrm {FSR} {=} {[} ( \ mathrm {E} _ {\ mathrm {p2}} {-} \ mathrm {E} _ {\ mathrm {p1}} \ mathrm {) / (E} _ {\ mathrm {M}} {\ times} т ) {]} {\ times} 60 {\ times} 100 $ |

, где E p1 и E p2 представляют собой обогащения связанного с белком l- [ кольцо 2 H 5 ] фенилаланина в точках отбора проб через 2 и 5 часов.Среднее внутриклеточное обогащение l- [кольцо- 2 H 5 ] фенилаланином составляет E M , тогда как время в минутах представлено как t . Чтобы выразить FSR в процентах в час, выражение затем умножается на коэффициенты 60 (минут в час) и 100 соответственно.

FBR. Мы кратко обсудим новый метод измерения фракционного распада белка, который был разработан и подробно описан ранее (9). Кроме того, метод FBR был недавно подтвержден в отчете этой лаборатории (20).В этом методе используется вариант традиционного метода исходных продуктов для определения FSR. В этом случае продуктом являются свободные внутриклеточные аминокислоты, а предшественниками — артериальная кровь и тканевый белок.

Метод FBR включает остановку обогащения после достижения изотопного равновесия 1- [ 15 N] фенилаланина и определение скорости распада внутриклеточного обогащения аминокислот. Скорость распада свободного внутриклеточного обогащения определяется артериальным распадом (который продолжает обеспечивать определенное количество метки для внутриклеточного пула, а также немеченых аминокислот) и FBR (который обеспечивает остальные немеченые аминокислоты) .{\ mathrm {t} _ {\ mathrm {2}}}} \ mathrm {E} _ {\ mathrm {F}} (t) dt} {\ times} \ \ frac {\ mathrm {T}} {\ mathrm {Q} _ {\ mathrm {F}}} $ |

, где P = E F / (E A — E F ) на изотопном плато, E A (t) и E F (t) — артериальное и внутриклеточное обогащение, а T / Q F — отношение связанной и несвязанной аминокислоты в образце ткани.

Без переменных P и T / Q F в приведенном выше уравнении уравнение представляет собой просто традиционное уравнение прекурсор-продукт.Традиционное уравнение прекурсор-продукт предполагает, что продукт получен только из одного прекурсора. Однако при определении FBR продукт имеет два источника: аминокислоты плазмы и аминокислоты, связанные с белками. Таким образом, эти два источника представлены переменной P. P равно отношению распада белка к переносу аминокислот в клетку и рассчитывается путем определения разбавления обогащения аминокислот между плазмой и внутриклеточным пространством в изотопном устойчивом состоянии.

Фактор T / Q F необходим для того, чтобы сделать единицы FBR сопоставимыми с единицами FSR, так что единицы FBR представляют собой скорость распада белка, деленную на размер пула связанных аминокислот. Традиционное уравнение прекурсор-продукт вычисляет скорость превращения прекурсора в продукт, деленную на размер пула продуктов. Однако в случае FBR скорость распада белка делится на размер пула свободных внутриклеточных аминокислот. Наконец, в этой модели FBR, а также при кинетическом определении скорости появления в результате распада белка (F M, O ) и исчезновения в результате синтеза белка (F O, M ) необходимо сделать предположение, что метка не возвращается из распада белка обратно в свободный внутриклеточный пул.Это разумно, учитывая низкое обогащение мышечного пула по сравнению со свободным внутриклеточным обогащением при изотопном равновесии. Таким образом, артериальная кровь остается единственным источником метки для свободного внутриклеточного пула. Напротив, немеченые аминокислоты как из артериальной крови, так и из распада белков вносят вклад в свободный внутриклеточный пул.

Статистический анализ. Сравнение базовых условий и условий лечения проводилось с использованием парных тестов t .Статистическая значимость установлена ​​при P ≤ 0,05. Данные представлены как среднее ± стандартная ошибка.

Результаты

Как показано в таблице 1, стабильное состояние артерии было достигнуто в течение часа отбора проб (240–300 мин) как в контрольный период, так и после 5 дней введения ОХ. Однако обогащение артерий было значительно выше после лечения ОХ (таблица 1; P <0,05). Из-за несоблюдения приема лекарств одним субъектом все представленные данные включают только результаты пяти субъектов.

Таблица 1.

Обогащение свободных аминокислот бедренной артерии

Мин вливания . фенилаланин .
Контроль (трассирующий / трассируемый) . Оксандролон (индикатор / след) .
240 0,0646 ± 0,0035 0,0759 ± 0,0032 a
260 0.0640 ± 0,0030 0,0722 ± 0,0016 a
280 0,0647 ± 0,0038 0,0672 ± 0,0025 a
300 0,0638 ± 0,0017 0,0638 ± 0,0017 0
Мин. Инфузия . фенилаланин .
Контроль (трассирующий / трассируемый) . Оксандролон (индикатор / след) .
240 0,0646 ± 0,0035 0,0759 ± 0,0032 a
260 0,0640 ± 0,0030 0,0722 ± 0,0016
0,0672 ± 0,0025 a
300 0,0638 ± 0,0017 0,0715 ± 0,0022 a
Таблица 1.

Обогащение аминокислот бедренной артерии

Мин. . фенилаланин . Контроль (трассирующий / трассируемый) . Оксандролон (индикатор / след) . 240 0,0646 ± 0,0035 0,0759 ± 0,0032 a 260 0,0640 ± 0,0030 0,0722 ± 0,0016 0,0672 ± 0,0025 a 300 0.0638 ± 0,0017 0,0715 ± 0,0022 a 9038 Концентрации OX в сыворотке на 3-й день (1,9 ± 0,4 нг / дл) и 5-й день (2,2 ± 0,3 нг / дл) введения OX, измеренные через 10 часов после перорального приема каждой вечерней дозы (2100 часов), оставались стабильными. Однако через 18 ч после лечения на 5-й день уровни OX в сыворотке крови были заметно снижены (0.48 ± 0,06 нг / дл; P <0,01) по сравнению с 10-часовыми значениями дня 3 или 5. Общие сывороточные концентрации Т были в пределах нормального физиологического диапазона в день 0 (449 ± 35 нг / дл) и день 3 (441 ± 44 нг / дл) лечения ОХ. Однако к 5 дню общие сывороточные концентрации Т были значительно снижены (282 ± 45 нг / дл; P <0,05) ниже значений дня 0 и дня 3 (рис. 3). Концентрации свободного Т в сыворотке крови были в пределах нормального физиологического диапазона в дни 0, 3 и 5. Однако к 5 дню концентрации свободного Т в сыворотке крови были значительно снижены (98 ± 10 пг / мл; P <0.001) ниже значений дня 0 (121 ± 12 пг / мл) и дня 3 (126 ± 9 пг / мл). Следовательно, общая концентрация андрогенов (T + OX) снижалась параллельно со снижением T (рис. 3).

Рисунок 3.

Общая концентрация андрогенов. Общая сывороточная концентрация Т ( заштрихованная часть ) и OX ( черная часть ) у пяти молодых людей в дни 0, 3 и 5 *, T значительно снизилась с дней 0 и 3 по 5 день ( P <0,05 ).

Рисунок 3.

Общая концентрация андрогенов. Общая сывороточная концентрация Т ( заштрихованная часть ) и OX ( черная часть ) у пяти молодых людей в дни 0, 3 и 5 *, T значительно снизилась с дней 0 и 3 по 5 день ( P <0,05 ).

FSR увеличился с 0,057 ± 0,004% до 0,082 ± 0,008% / час после 5 дней введения ОХ (рис.4; P <0,05), тогда как FBR остался неизменным (0,138 ± 0,005% против 0,118 ± 0,0008 % / час; P = 0.40). Внешний вид фенилаланина в целом снизился с 0,80 ± 0,03 до 0,75 ± 0,03 мкмоль / кг · мин после обработки ОХ ( P <0,05).

Рисунок 4.

Мышечный белок FSR. FSR мышечного белка у пяти молодых мужчин во время постабсорбтивного состояния как до (контроль, открытая полоса , ), так и после (OX, черная полоса ) введения ОХ. *, Пять дней приема ОХ увеличивали скорость синтеза мышечных белков примерно на 44% ( P <0.05).

Рисунок 4.

Мышечный белок FSR. FSR мышечного белка у пяти молодых мужчин во время постабсорбтивного состояния как до (контроль, открытая полоса , ), так и после (OX, черная полоса ) введения ОХ. * Пять дней приема ОХ увеличивали скорость синтеза мышечных белков примерно на 44% ( P <0,05).

Полученные из модели параметры кинетики свободных аминокислот в мышцах ног пяти субъектов в контрольный период и после 5 дней ОХ показаны в таблице 2.Обработка ОХ не влияла на доставку аминокислоты (F в ) или высвобождение меченого фенилаланина из ноги (F из ). Более того, скорость внутреннего транспорта (F M, A ) фенилаланина осталась неизменной. Однако 5 дней приема ОХ привели к значительному снижению скорости внешнего транспорта фенилаланина (F V, M ; P <0,05). Внутриклеточная скорость появления фенилаланина (F M, O ), показатель протеолиза, не изменилась после введения ОХ (таблица 2).Однако, в соответствии с данными прямого включения, скорость внутриклеточного использования фенилаланина для синтеза белка (F O, M ) значительно увеличилась после обработки OX (таблица 2; P <0,05). В результате увеличения F O, M и отсутствия изменений в F M, O чистый баланс (NB) сместился с чистого отрицательного выхода (-30 ± 6) во время контрольного периода натощак на приблизительный нулевой баланс (-1 ± 4) во время ночного голодания после 5 дней ОХ (Таблица 2; P <0.05). Эффективность синтеза белка значительно увеличивалась от контроля до периода OX (24 ± 0,03% против 39 ± 0,07%; P <0,05). Наконец, OX не влиял на кровоток в ногах.

Таблица 2.

Влияние лечения оксандролоном на кинетику свободных аминокислот в мышцах ног у молодых мужчин

Мин. Инфузия . фенилаланин .
Контроль (трассирующий / трассируемый) . Оксандролон (индикатор / след) .
240 0,0646 ± 0,0035 0,0759 ± 0,0032 a
260 0,0640 ± 0.0030 0,0722 ± 0,0016 a
280 0,0647 ± 0,0038 0,0672 ± 0,0025 a
300 0,0638 ± 0,0017 0,0638 ± 0,0017
228 9038 F M, A (транспортировка внутрь)
Кинетический параметр . фенилаланин .
Управление . Оксандролон .
F в (артериальное родоразрешение) 263 ± 46 227 ± 42
F из (венозный отток) 293 ± 46 144 ± 17 124 ± 25
F V, M (транспортировка наружу) 175 ± 15 125 ± 29 a
F V, A (функциональное шунтирование) 118 ± 35 102 ± 17
F M, O (расщепление белка) 83 ± 8 69 ± 8
F O, M (синтез белка) 53 ± 3 68 ± 5 a
Ra M (внутриклеточный вид) 228 ± 16 193 ± 32
N остаток нетто) −30 ± 6 −1 ± 4 a
228 9038 F M, A (транспортировка внутрь)
Кинетический параметр . фенилаланин .
Управление . Оксандролон .
F в (артериальное родоразрешение) 263 ± 46 227 ± 42
F из (венозный отток) 293 ± 46 144 ± 17 124 ± 25
F V, M (транспортировка наружу) 175 ± 15 125 ± 29 a
F V, A (функциональное шунтирование) 118 ± 35 102 ± 17
F M, O (расщепление белка) 83 ± 8 69 ± 8
F O, M (синтез белка) 53 ± 3 68 ± 5 a
Ra M (внутриклеточный вид) 228 ± 16 193 ± 32
N остаток нетто) −30 ± 6 −1 ± 4 a
Таблица 2.

Влияние лечения оксандролоном на кинетику свободных аминокислот в мышцах ног у молодых мужчин

228 9038 F M, A (транспортировка внутрь)
Кинетический параметр . фенилаланин .
Управление . Оксандролон .
F в (артериальное родоразрешение) 263 ± 46 227 ± 42
F из (венозный отток) 293 ± 46 144 ± 17 124 ± 25
F V, M (транспортировка наружу) 175 ± 15 125 ± 29 a
F V, A (функциональное шунтирование) 118 ± 35 102 ± 17
F M, O (расщепление белка) 83 ± 8 69 ± 8
F O, M (синтез белка) 53 ± 3 68 ± 5 a
Ra M (внутриклеточный вид) 228 ± 16 193 ± 32
N остаток нетто) −30 ± 6 −1 ± 4 a
228 9038 F M, A (транспортировка внутрь)
Кинетический параметр . фенилаланин .
Управление . Оксандролон .
F в (артериальное родоразрешение) 263 ± 46 227 ± 42
F из (венозный отток) 293 ± 46 144 ± 17 124 ± 25
F V, M (транспортировка наружу) 175 ± 15 125 ± 29 a
F V, A (функциональное шунтирование) 118 ± 35 102 ± 17
F M, O (расщепление белка) 83 ± 8 69 ± 8
F O, M (синтез белка) 53 ± 3 68 ± 5 a
Ra M (внутриклеточный вид) 228 ± 16 193 ± 32
N остаток нетто) -30 ± 6 -1 ± 4 a

ОХ введение значительно увеличивало концентрации мРНК AR скелетных мышц без изменения концентрации мРНК IGF-I.На Фигуре 5 представлена ​​репрезентативная авторадиограмма гибридизации по Саузерну для AR скелетных мышц и график данных денситометрии от всех пяти субъектов. Концентрации мРНК IGF-I не были значительно увеличены после 5 дней лечения OX (контроль, 2,3 ± 0,6; OX, 3,1 ± 0,5). Концентрация ГАП не изменилась. Данные представлены как отношение плотности полосы AR к плотности полосы GAP.

Рисунок 5.

Концентрации мРНК AR. Top , Репрезентативная авторадиограмма Саузерн-блот-гибридизации продукта ОТ-ПЦР из общей РНК биоптатов мышц трех субъектов, получавших ОХ (15 мг / день в течение 5 дней).GAP использовался в качестве внутреннего контроля. C, контроль; О, ОХ. Внизу , график среднего ± стандартная ошибка всех пяти субъектов. Данные выражены в произвольных единицах, рассчитанных как отношение плотностей полос AR к плотностям полос GAP (внутренний контроль). Статистическая значимость определялась парным тестом t (*, P ≤ 0,05).

Рисунок 5.

Концентрации мРНК AR. Top , Репрезентативная авторадиограмма Саузерн-блот-гибридизации продукта ОТ-ПЦР из общей РНК биоптатов мышц трех субъектов, получавших ОХ (15 мг / день в течение 5 дней).GAP использовался в качестве внутреннего контроля. C, контроль; О, ОХ. Внизу , график среднего ± стандартная ошибка всех пяти субъектов. Данные выражены в произвольных единицах, рассчитанных как отношение плотностей полос AR к плотностям полос GAP (внутренний контроль). Статистическая значимость определялась парным тестом t (*, P ≤ 0,05).

Обсуждение

Мы исследовали реакцию кинетики мышечного белка на введение OX у нормальных молодых мужчин.Мы продемонстрировали, что умеренная доза ОХ в течение 5 дней стимулировала анаболизм мышечного белка у молодых мужчин. Кроме того, мы впервые продемонстрировали на людях увеличение АР скелетных мышц после анаболического вмешательства. Мышечный анаболизм во время лечения ОХ происходил за счет стимуляции синтеза белка, так как распад белка не изменился. Более того, значительное снижение модельного внешнего транспорта (F V, M ) наряду с рассчитанным увеличением эффективности синтеза белка указывает на усиление внутриклеточного повторного использования аминокислот.Взятые вместе, эти результаты демонстрируют механизм анаболических свойств OX в скелетных мышцах натощак.

Недавнее исследование в нашей лаборатории (7) продемонстрировало, что через 5 дней после однократной в / м инъекции ТЕ (200 мг) синтез белка FSR и модельного белка увеличился в 2 раза без изменения FBR. Кроме того, в соответствии с настоящими выводами, Ferrando et al. (7) продемонстрировал повышенное использование внутриклеточных аминокислот, продемонстрировав сильную взаимосвязь между распадом белка и синтезом белка.Хотя наши кинетические данные убедительно подтверждают эти выводы, величина синтетического ответа с OX была не такой большой, как с TE. С помощью OX мы обнаружили 44% и 28% увеличения FSR и синтеза белка на основе модели (F O, M ), соответственно. Эти различия могут объясняться несколькими важными факторами.

В нашем предыдущем исследовании общая концентрация Т увеличилась вдвое по сравнению с физиологической нормой через 2 дня после инъекции ТЕ (2094 ± 561 нг / дл). Кроме того, T был все еще в верхнем физиологическом диапазоне (953 ± 283 нг / дл) к 5 дню и статистически отличался от концентрации T перед инъекцией (425 ± 99 нг / дл) (7).Напротив, величина ответа, которую мы обнаружили в концентрации OX в сыворотке, была намного меньше, чем у ТЕ. Например, общий OX в сыворотке, измеренный утром через 10 часов после перорального приема, был постоянным в дни 3 и 5, тогда как концентрации общего сывороточного и свободного T значительно снизились с 0 и 3 по 5 день. уровни андрогенов при лечении ОХ были намного ниже, чем при лечении ТЕ. Хотя общее воздействие андрогенов на скелетные мышцы с помощью OX могло быть значительно меньше, чем то, которое мы обнаружили ранее с TE, тем не менее наблюдалось увеличение синтеза белка.Это говорит о том, что OX может оказывать большее анаболическое влияние на скелетные мышцы, чем TE, тем самым преодолевая снижение концентрации T.

Дополнительные данные указывают на то, что способ введения и метаболизм анаболического агента может определять величину разницы в синтезе белка с OX по сравнению с TE. Например, инъекции im TE вводятся на липидной основе, так что они могут накапливаться в жировой ткани и медленно высвобождаться, обеспечивая длительную продолжительность действия.После внутримышечной инъекции 200 мг ТЕ уровни Т в сыворотке повышаются и могут достигать супрафизиологического диапазона в течение 24 часов после введения. В течение нескольких недель эти уровни постепенно снижаются до гипогонадальных уровней (21). В настоящем исследовании уровни OX в сыворотке на 5-й день составили 2,19 нг / дл через 10 часов после перорального приема. Однако к 18 часам уровни OX в сыворотке упали до 0,48 нг / дл, что составляет 78% снижение содержания OX в сыворотке всего за 8 часов. Из-за этого быстрого снижения уровня OX в крови может быть оправдано введение OX два раза в день для поддержания более высоких устойчивых уровней общего андрогена в крови, возможно, еще больше усиливая его анаболический эффект на скелетные мышцы.

Более того, мощная реакция синтеза белка OX была достаточной для улучшения чистого оттока аминокислот и катаболизма белков, связанных с ночным голоданием. Учитывая, что у большинства пациентов с травмами и ожогами наблюдается острая гиперкатаболизм, а у большинства больных раком и СПИДом — хронический катаболизм, возможность обратить вспять неизбежную потерю безжировой массы тела с помощью пероральных анаболических агентов имеет значительные клинические последствия. Однако сроки, необходимые для накопления белка в этих группах пациентов, неизвестны.Как минимум, эффективное повторное использование внутриклеточных аминокислот необходимо для постоянного поддержания метаболического состояния (7, 22). Мы знаем, что во время голодания расщепление белка обычно намного выше, чем его синтез (16, 22). Несмотря на голодание в течение ночи, у всех субъектов было повышенное повторное использование аминокислот, поскольку внешний транспорт (F V, M ) снизился на 28% после лечения ОХ. Мы также показали увеличение эффективности синтеза белка с помощью OX на 65%. В сочетании это могло привести к увеличению безжировой массы тела после еды.

Андрогены вызывают свой специфический ответ через AR, который, в свою очередь, регулирует транскрипцию андроген-чувствительных генов-мишеней. Хотя мы знаем, что накопление ДНК необходимо для роста мышц, механизмы индуцированной андрогенами аккреции ДНК в скелетных мышцах неясны. AR (23) и мРНК AR (24) были обнаружены в скелетных мышцах человека. Однако на сегодняшний день нет исследований на людях, в которых изучалась бы реакция AR скелетных мышц на воздействие андрогенов. Более того, было высказано предположение, что предшествующее клеточное воздействие андрогенов может каким-то образом подготовить эти клетки к действию вторичных агентов, таких как IGF-I.Следовательно, вторичной целью этого исследования было изучить влияние введения OX на концентрацию мРНК IGF-I и AR.

Недавнее исследование упражнений на крысах показало, что наращивание скелетных мышц может зависеть от увеличения количества AR (25). Inoue et al. (25) исследовали физиологическое значение увеличения AR для гипертрофии мышц, вызванной физической нагрузкой. Они определили, что андрогенный путь оказывает значительное влияние на мышечную гипертрофию, вызванную физической нагрузкой, и обнаружили, что гипертрофия связана с увеличением количества АР в тренированной мышце (25).Более того, исследование, проведенное Doumit et al. (26) обнаружили, что предварительная обработка сателлитных клеток свиней Т в течение 24 часов активирует AR, но не изменяет чувствительность этих клеток к IGF-I или другим факторам роста. Точно так же мы обнаружили повышенную экспрессию мРНК AR без изменения концентраций мРНК im IGF-I после кратковременного введения OX. Эти данные вместе с нашими выводами о повышенных концентрациях мРНК AR при кратковременном воздействии OX подтверждают утверждение о том, что AR могут прямо или косвенно регулировать накопление ДНК, необходимой для роста мышц.

Более свежие данные подтверждают взаимодополняющие роли андрогенов, AR и IGF-I. Urban et al. (5) обнаружил повышенные концентрации мРНК IGF-I в скелетных мышцах пожилых мужчин, получавших в течение 4 недель замещающие дозы TE. Кроме того, вызывая тяжелый дефицит андрогенов у молодых мужчин в течение 10 недель, Mauras et al. (27) показал заметное снижение концентраций мРНК IGF-I и предположил, что в ткани скелетных мышц андрогены необходимы для местного производства IGF-I, независимо от продукции GH и системных концентраций IGF-I.Кроме того, новые данные этого исследования с участием мужчин с дефицитом андрогенов показывают, что АР значительно уменьшаются в ответ на тяжелый гипогонадизм (28). Хотя нет прямых доказательств того, что OX связывается с AR, результаты настоящего исследования и данные Hayes et al. (28) предполагают, что андрогены могут действовать непосредственно через рецептор андрогенов, оказывая свое влияние на метаболизм белков. Тем не менее, мы не знаем из настоящего исследования физиологического значения повышенной экспрессии мРНК для AR.

Таким образом, это исследование демонстрирует, что ОХ, вводимый один раз в день в умеренной дозе (15 мг / день), способствует синтезу чистого мышечного белка. Более того, эти данные предполагают, что OX индуцировал увеличение экспрессии AR как механизм увеличения синтеза чистого мышечного белка.

Исследователи выражают благодарность медсестрам и персоналу Центра клинических исследований Университета Техаса за их помощь в этом проекте, Лакшми МакРэй за поддержку медсестер, Чжи Пинг Донгу и Боро Старчевичу за анализ образцов, а также BTG Pharmaceuticals Co., Inc., за предоставление исследуемого препарата.

1

Бродский

ИГ

,

Балагопал

П

, Наир КС.

1996

Влияние замены тестостерона на мышечную массу и синтез мышечного белка у мужчин с гипогонадизмом — исследование центра клинических исследований.

Дж Клин Эндокринол Метаб

.

81

:

3469

3475

.2

Кацнельсон

L

,

Кинкельштайн

JS

,

Schoenfeld

DA

000,

0002 Rosenthal

000,

Rosenthal

000,

Rosenthal

000 А.

1996

Увеличение плотности костей и безжировой массы тела при введении тестостерона у мужчин с приобретенным гипогонадизмом.

Дж Клин Эндокринол Метаб

.

81

:

4358

4365

.3

Бхасин

S

,

Storer

TW

,

Берман

N

и др.

1997

Замещение тестостерона увеличивает безжировую массу и размер мышц у мужчин с гипогонадизмом.

Дж Клин Эндокринол Метаб

.

82

:

407

413

,4

Tenover JS.

1992

Влияние добавок тестостерона на стареющих мужчин.

Дж Клин Эндокринол Метаб

.

75

:

1092

1098

,5

Городской

RJ

,

Боденбург

C

,

Gilkison

C

и др.

1995

Введение тестостерона пожилым мужчинам увеличивает силу скелетных мышц и синтез белка

.

Am J Physiol.

269

:

E820

E826

,6

Grinspoon

S

,

Corcoran

C

,

Lee

K

и др.

1996

Потеря безжировой массы тела и мышечной массы коррелирует с уровнями андрогенов у гипогонадных мужчин с синдромом приобретенного иммунодефицита истощения.

Дж Клин Эндокринол Метаб

.

81

:

4051

4058

,7

Феррандо

AA

,

Tipton

KD

,

Doyle

D

,

Phillips

SM

SM

Вулф

РУБ

.

1998

Инъекция тестостерона стимулирует чистый синтез белка, но не тканевой транспорт аминокислот

.

Am J Physiol.

275

:

E864

E871

.8

Griggs

RC

,

Kingston

W

,

Jozefowicz

RF

,

Herr

Холлидей Д.

1989

Влияние тестостерона на мышечную массу и синтез мышечного белка.

J Appl Physiol

.

66

:

498

503

,9

Zhang

X-J

,

Chinkes

DL

,

Sakurai

Y

,

Wolfe

RR

1996

Изотопный метод измерения скорости фракционного распада мышечного белка in vivo

.

Am J Physiol.

270

:

E759

E767

.10

Berger

JR

,

Pall

L

,

Hall

CD

,

Simpson

000 DM

000 DM Дадли Р.

1996

Оксандролон при миопатии из-за СПИДа.

СПИД

.

10

:

1657

1662

.11

Демлинг

RH

, DeSanti L.

1997

Оксандролон и анаболические стероиды значительно увеличивают скорость набора веса в фазе восстановления после серьезных ожогов.

J Травма

.

43

:

47

51

.12

Wilson

DM

,

McCauley

E

,

Brown

DR

, Dudley R.

1995

Терапия оксандролоном при конституциональной задержке роста и полового созревания. Кооперативная исследовательская группа «Био-Технологии Дженерал Корпорейшн».

Педиатрия

.

96

:

1095

1000

,13

Розенфельд

RG

,

Attie

KM

,

Frane

J

и др.

1998

Гормональная терапия синдрома Тернера: положительное влияние на рост взрослого человека.

J Педиатр

.

132

:

319

324

,14

Fenichel

G

,

Pestronk

A

,

Florence

J

,

Robison

9000 9000

Vt

Благоприятный эффект оксандролона при лечении мышечной дистрофии Дюшенна: пилотное исследование.

Неврология

.

48

:

1225

1226

,15

Биоло

G

,

Chinkes

D

,

Zhang

X

, Wolfe RR.

1992

Новая модель для определения in vivo взаимосвязи между трансмембранным транспортом аминокислот и кинетикой белка в мышцах.

J Parenter Enteral Nutr

.

16

:

305

315

.16

Biolo

G

,

Fleming

RYD

,

Maggi

SP

,

Wolfe

RR

.

1995

Трансмембранный транспорт и внутриклеточная кинетика аминокислот в скелетных мышцах человека

.

Am J Physiol.

268

:

E75

E84

,17

Wolfe

рупий.

1992

Индикаторы радиоактивных и стабильных изотопов в биомедицине: принципы и практика кинетического анализа.

Нью-Йорк

:

Вили-Лисс.

18

Bergstrom

J

,

Furst

L

,

Noree

L-O

, Vinnars E.

1974

Внутриклеточная концентрация свободных аминокислот в мышечной ткани человека.

J Appl Physiol

.

36

:

693

697

,19

Calder

AG

,

Anderson

SE

,

Grant

I

,

McNurlan

MA

.

1992

Определение низкого обогащения d 5 -фенилаланином (избыток 0,002–0,09 атомных процентов) после преобразования в фенилэтиламин в связи с исследованиями оборота белков с помощью газовой хроматографии / электронно-ионизационной масс-спектрометрии.

Масс-спектр Rapid Commun

.

6

:

421

424

.20

Phillips

SM

,

Tipton

KD

,

Aarsland

A

,

Wolf

SE

,

Wolf

SE

,

1997

Синтез и распад смешанного мышечного белка после упражнений с отягощениями у людей

.

Am J Physiol.

273

:

E99

E107

.21

Сокол

RZ

,

Palacios

A

,

Campfield

LA

,

Saul

C

, Swerdloff RS.

1982

Сравнение кинетики инъекционного тестостерона у эугонадальных и гипогонадальных мужчин.

Fertil Steril

.

37

:

425

430

.22

Биоло

G

,

Fleming

D

, Wolfe RR.

1998

Физиологическая гиперинсулинемия стимулирует синтез белка и увеличивает транспорт выбранных аминокислот в скелетных мышцах человека.

Дж Клин Инвест

.

95

:

811

819

.23

Кимура

N

,

Mizokami

A

,

Oonuma

T

,

Sasano

Hagura

1993 Иммуницитохимическая локализация рецептора андрогена с поликлональным антителом в тканях человека, залитых паррафином.

J Histochem Cytochem

.

41

:

671

678

.24

Chang

C

,

Kokontis

J

, Liao S.

1988

Структурный анализ комплементарной ДНК и аминокислотных последовательностей андрогенных рецепторов человека и крысы.

Proc Natl Acad Sci USA

.

85

:

7211

7215

.25

Иноуэ

K

,

Ямасаки

S

,

Fushiki

T

,

Okada

Y.Sugim 9000

1994

Антагонист рецепторов андрогенов подавляет вызванную физической нагрузкой гипертрофию скелетных мышц.

Eur J Appl Physiol

.

69

:

88

91

.26

Думит

ME

,

Cook

DR

, Merkel RA.

1996

Тестостерон активирует рецепторы андрогенов и снижает дифференцировку миогенных сателлитных клеток свиней in vitro .

Эндокринология

.

137

:

1385

1394

.27

Маурас

N

,

Hayes

V

,

Welch

S

и др.

1998

Дефицит тестостерона у молодых мужчин: заметные изменения в кинетике белков всего тела, силе и ожирении.

Дж Клин Эндокринол Метаб

.

83

:

1886

1892

,28

Hayes V, Jiang J, Urban RJ, Mauras N. IGF-I и андрогенные стероиды: синергетические эффекты у человека [Аннотация].Материалы 81-го ежегодного собрания The Endocrine Soc. 1999. с. 571.

Авторские права © 1999, Общество эндокринологов

Произошла ошибка при установке пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно.Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом.Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу.Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в файле cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта.Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

Произошла ошибка при установке пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности. Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно.Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались. Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом.Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie. Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу.Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в файле cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта.Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

Локации: энергетическая группа квазаров

РАСПОЛОЖЕНИЕ ОФИСОВ

Штаб-квартира компании, разработка и лаборатория

8600 Ист-Плезант Вэлли-роуд

Индепенденс, Огайо 44131

Часы работы

понедельник — пятница (8:00 — 17:00)

суббота закрыта

выходной

Лаборатория Вустера

Кампус OARDC Университета штата Огайо

2705 Селби Роуд

Вустер, Огайо 44691

АНАЭРОБНЫЕ ДИГЕСТЕРЫ И АГНКС

Действующие анаэробные варочные котлы с квазарной технологией перечислены ниже.Объекты с общедоступными заправочными станциями КПГ отмечены звездочкой (*).

Часы работы

понедельник — пятница (7:00 — 17:00)

Суббота (7:00 — 13:00)

выходной

Огайо

Эшли, Огайо — Ringler Energy

2279 Каунти-роуд 156

Эшли, Огайо 43003

Кливленд, Огайо — Collinwood BioEnergy

13550 проспект Аспинуолл

Кливленд, Огайо 44110

* Колумбус, Огайо — Биоэнергетика Центрального Огайо

АГНКС

2506 Джексон Пайк

Колумбус, Огайо 43223

Фэйрборн, Огайо — Dovetail Energy

1146 Herr Road

Фэйрборн, Огайо 44304

Хэвиленд, Огайо — Хэвиленд Энерджи

, 115 West Main Street,

Хэвиленд, Огайо 45851

Нортон, Огайо — Лайм Лейкс Энерджи

1743 Vanderhoof Road

Нортон, Огайо 44203

North Ridgeville, OH — Three Creek BioEnergy

2350 Abbe Road

Шеффилд-Виллидж, Огайо 44054

Толедо, Огайо — WWRF округа Лукас

5758 North River Road

Вотервиль, Огайо 43566

Вустер, Огайо — Buckeye Biogas

Исследовательский парк BioHio — OARDC

2072 Secrest Road

Вустер, Огайо 44691

Вустер, Огайо — Возобновляемая энергия Вустера

Завод по борьбе с загрязнением воды в Вустере

1123 Old Columbus Road

Вустер, Огайо 44691

Занесвилл, Огайо — Занесвилл Энерджи

6400 Мэйсвилл Пайк

Занесвилл, Огайо 43701

ГЛАВНАЯ

Brunswick, ME — Village Green

Орион улица 170 (индекс

)

Brunswick, ME 04011

МАССАЧУСЕТЦ

Рултанд, Массачусетс — AGreen Energy

51 Mushopauge Road

Ратленд, Массачусетс 01543

НЬЮ-ЙОРК

Wheatfield, NY — Niagara BioEnergy

2175 Либерти Драйв

Wheatfield, NY 14304

West Seneca, NY — Buffalo BioEnergy

2900 Северная Америка Привод

West Seneca, NY 14224

Исследования взаимодействия газа и твердых тел в Корнелле

Исследование взаимодействий газа и твердого тела в школе Сибли


Помимо наших экспериментов по циркуляционному псевдоожижению, мы также изучили взаимодействие газов и взволнованных твердых тел.Обычно мы рассматриваем твердые тела, которые достаточно взволнованы, чтобы повлиять на окружающий газ, но они слишком массивны, чтобы их можно было значительно сдвинуть по газу. Мы рассмотрели механику жидкости и тепло перенос в плотных суспензиях газов и взволнованных твердых тел, с применения на пневмотранспорте массивных частиц.

Вызов теории — образование кластеров частиц. Следующая статья указывает на недавний прогресс, достигнутый Митрано и др. (2014) в отношении кластеров: M.Y. Louge: «Удивительная актуальность описания континуума для гранулированных кластеров», J. Fluid Mech. 742, 1-4 (2014), DOI: 10.1017 / jfm.2013.650.

Результаты газо-твердой суспензии


Наши основные публикации по этой теме:

Х. Сюй, Р. Верберг, Д.Л. Кох, М.Ю. Louge: «Плотный, ограниченные сдвиговые потоки взволнованных твердых сфер в газе на промежуточных Стокса и конечные числа Рейнольдса, J. ​​Fluid Mech. (2009), т. 618. С. 181–208.

В этой статье мы описываем теорию, фиксирующую решетку-Больцмана. численное моделирование Верберга и Koch (2006) для массивных частиц, сдвигающихся в присутствии межузельный газ между двумя неровными границами.Мы использовали эти результаты для прогнозировать усиление теплопередачи при перемешивании подвески.


Моделирование Больцмана на решетке Верберга и Коха. В фильме показаны сферические зерна и линии скорости газа вокруг их.
(Крис Пелки визуализировал симуляцию).

Louge, M.Y., Mastorakos, E. and Дженкинс, Дж. Т .: « Роль столкновений частиц в пневматическом транспорте, J. of Fluid. Мех. 231, 345-359 (1991).

В этой статье мы анализируем устойчивый, полностью развитый поток массивные частицы (т.е., большие числа Стокса) в турбулентной газ в вертикальной трубе. В этом режиме перемешивание частиц задается бинарными столкновениями между зернами, а не взаимодействием с скорость колебания газа. Проверяем теорию на данных Цуджи и др. (1984).
Отрывок из произведений Louge, Mastorakos и Jenkins (1991). доступно здесь.

Х. Сюй: «Столкновения гранулярных потоков с и без взаимодействия газов в условиях микрогравитации, кандидатская диссертация, Корнельский университет (2003).

Доктор философии Хайтао Сюй. диссертация содержит информацию о границах условия, гранулированная сегрегация и газо-твердые взаимодействия.


Результаты теплообмена

X. Чен и М.Ю. Louge: «Жара усиление переноса в плотных суспензиях взбалтываемых твердых веществ. Часть I: Теория », International J. Heat Mass Transfer, 51 (2008) 5108–5118.

В этой статье излагается новая теория улучшения теплопередачи. через плотные однородные взвеси взволнованных твердых частиц в проводящих жидкости.Теория связывает жидкую и твердую фазы через объемный исходный термин. Улучшение регулируется Damkohler число, обозначающее «лимит обмена», где преобладает исходный термин, и «предел диффузии», установленный способностью перемешиваемых частиц к самодиффузный. Отметим влияние упорядочения частиц на электропроводность смеси и объемную скорость теплообмена, проводят тепловое моделирование, чтобы обосновать форму этих терминов, и модель дальнейшее усиление за счет колебаний скорости газа, вызванных твердыми телами сильного волнения.

X. Чен и М.Ю. Louge: «Жара усиление переноса в плотных суспензиях взбалтываемых твердых веществ. Часть II: Эксперименты в пределе обмена », International J. Heat Mass Передача, 51 (2008) 5119–5129.

Проверяем теорию Части I на бирже ограничить вибрацией акриловых и алюминиевых сфер в коробке, состоящей из две плоские, вертикальные изотермические стены, две неровные, горизонтальные, изолированные стены и две плоские вертикальные изолированные поверхности. Устойчивая жара поток через термозащищенную горячую стенку регистрируется на разных температуры противоположной стенки, охлаждаемой термоэлектрическими модулями, и увеличения проводимости суспензии рассчитываются с использованием модель коробки с сосредоточенными параметрами.Для сравнения результатов и теории мы также прогнозировать вертикальные профили перемешивания и объемной доли твердого вещества в коробке с использованием гранулярной динамики.

Вибрирующий ящик, который мы использовали регистрируют теплоотдачу в плотных суспензиях взбалтываемых зерен. Типичное сравнение экспериментальных результатов и теории для теплопередачи в суспензиях взбалтываемых зерен.
М.Ю. Louge и X. Chen: «Жара перечислить усиление в плотных суспензиях взбалтываемых твердых веществ. Часть III: Термофоретический транспорт наночастиц в диффузионном пределе.”, International J. Heat Mass Transfer, 51 (2008) 5130–5143.

В этой статье экстраполируется предел диффузии, обсуждаемый в Части I. к суспензиям наночастиц в жидкости. Мы скептически относимся к об исключительных улучшениях теплопередачи, о которых сообщалось в литературе.

Поскольку наночастицы возбуждаются броуновским движением, их самодиффузия умеренная, жидкая и твердая фазы имеют одинаковые температура, и теория смеси должна предсказать эффективную суспензию проводимость.Покажем, как термофорез создает суспензию. неоднородности, предложить способы устранения последних с помощью ультразвуковой воздействия и изучите последствия для теплопередачи. Проинформировать дискуссии о теплопередаче наножидкостей, мы показываем, что аномальная проводимость улучшения, о которых сообщается с помощью термоэлектрической теплопроводности, могут быть экспериментальный артефакт термофоретической миграции по температуре градиент или время в наблюдениях.

Мы предоставляем заархивированные файлы, содержащие документы Matlab, Mathematica и Excel, которые мы использовали для выполнения вычислений для Части I, Части II и Части III. Чена и Лоуге (2008).Эти программы включают в себя самые разные прогнозы. как нелинейное поведение одномерной вибрирующей гранулированной системы, основанное на кинетической теории гранулированных газов, функция пространственного распределения сфер на плоской стенке, термофорез наночастиц, переходные растворы для термообработки кондуктометрия, ультразвуковое нагнетание наножидкостей и др. За объяснения, сначала см. текстовый файл readme; затем посмотрите комментарии в соответствующие программы.

Louge, M., Mohd. Юсоф Дж. И Дженкинс Дж.Т .: «Тепло Перенос в пневматическом транспорте массивных частиц », Int. J. Heat & Mass Trans. 36 (2), 265-275 (1993).

В этой статье мы анализируем устойчивую, полностью развитую теплопередачу. к стенкам вертикальной трубы от разбавленной турбулентной взвеси массивные частицы в газе. Мы используем теорию Лужа, Масторакоса и Дженкинса. для гидродинамики суспензии, и запишем связанные уравнения для тепловых энергий частицы и газовой фазы. Мы тестируем теория против данных Jepson, et al.Эта статья является предшественником более поздняя теория Чена и Louge для суспендирования взбалтываемых зерен в газе.
Отрывок из Louge, Mohd. Юсоф и Дженкинс (1993) доступно здесь.


Эксперименты в условиях микрогравитации


НАСА-Исследовательский центр Гленна спонсировал наш проект SiGMA (Solids Взаимодействие с газом в аппарате микрогравитации), который был частью Модуль гранулированного потока на Международной космической станции, с 1998 г. по 2005 г. Окончательный отчет представлен ниже.Мы успешно протестировали собственный прототип установки на микрогравитационном самолете НАСА KC-135. Тестовая матрица Об экспериментах, которые мы запланировали для космического пространства, содержится в докторской диссертации Хайтао Сюй.

M.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *